abca1a

Ensembl ID:
ENSDARG00000074635
ZFIN ID:
ZDB-GENE-031006-12
Description:
ATP-binding cassette sub-family A member 1 [Source:RefSeq peptide;Acc:NP_001139161]
Human Orthologue:
ABCA1
Human Description:
ATP-binding cassette, sub-family A (ABC1), member 1 [Source:HGNC Symbol;Acc:29]
Mouse Orthologue:
Abca1
Mouse Description:
ATP-binding cassette, sub-family A (ABC1), member 1 Gene [Source:MGI Symbol;Acc:MGI:99607]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15548 Essential Splice Site Available for shipment Available now
sa5800 Essential Splice Site F2 line generated During 2014
sa2010 Essential Splice Site F2 line generated During 2014
sa5665 Nonsense Mutation detected in F1 DNA Unknown
sa928 Essential Splice Site F2 line generated During 2014
sa12376 Essential Splice Site Available for shipment Available now
sa9624 Essential Splice Site Available for shipment Available now
sa13007 Essential Splice Site Available for shipment Available now
sa4868 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15548
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051558 Essential Splice Site 507 2268 11 49
ENSDART00000142465 Essential Splice Site 507 2268 11 49
ENSDART00000051558 Essential Splice Site 507 2268 11 49
ENSDART00000142465 Essential Splice Site 507 2268 11 49

The following transcripts of ENSDARG00000074635 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 53089837)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCAACGAGACTGAYCAGGCCATACAGACCATCTCMCGCTTCATGGAGG[T/C]ACACAGTTTTATCTTCCTTAACGWCCTATTATCATTATCWTCATAKGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5800
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051558 Essential Splice Site 507 2268 11 49
ENSDART00000142465 Essential Splice Site 507 2268 11 49
ENSDART00000051558 Essential Splice Site 507 2268 11 49
ENSDART00000142465 Essential Splice Site 507 2268 11 49

The following transcripts of ENSDARG00000074635 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 53089837)
KASP Assay ID:
554-3387.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCAACGAGACTGAYCAGGCCATACAGACCATCTCCCGCTTCATGGAGG[T/C]ACACAGTTTTATCTTCCTTAACGTCCTATTATCATTATCWTCATATGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2010
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051558 Essential Splice Site 507 2268 11 49
ENSDART00000142465 Essential Splice Site 507 2268 11 49
ENSDART00000051558 Essential Splice Site 507 2268 11 49
ENSDART00000142465 Essential Splice Site 507 2268 11 49

The following transcripts of ENSDARG00000074635 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 53089837)
KASP Assay ID:
554-3387.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCAACGAGACTGAYCAGGCCATACAGACCATCTCCCGCTTCATGGAGG[T/C]ACACAGTTTTATCTTCCTTAACGTCCTATTATCATTATCWTCATATGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051558 Nonsense 771 2268 15 49
ENSDART00000142465 Nonsense 771 2268 15 49

The following transcripts of ENSDARG00000074635 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 53095107)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCATCATTTACTTCACGCTTTACCTGCCCTATGTGCTCTGCGTYGCCTG[G/A]CAGAACTACGTRGGCTTCGGTGCCAAAATAGTAGTGGTGAGTGCAAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa928
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051558 Essential Splice Site 991 2268 19 49
ENSDART00000142465 Essential Splice Site 991 2268 19 49

The following transcripts of ENSDARG00000074635 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 53098062)
KASP Assay ID:
554-0833.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCGCCAAAACCTGGGCGTCTGTCCTCAGCATAACGTCCTGTTCAGCAT[G/A]TACGTCCACAACACACCTTTTTACACATTTTACACACTCTTTCATGGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12376
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051558 Essential Splice Site 1083 2268 21 49
ENSDART00000142465 Essential Splice Site 1083 2268 21 49

The following transcripts of ENSDARG00000074635 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 53099554)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTTACGCCCGCCGTGGCATCTGGGACCTGCTGCTGAAATACCGCCAAG[G/A]TAAACATCTGCAATAAAAAACAGCCTWTAATTACAWTAAATATGTCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9624
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051558 Essential Splice Site 1432 2268 30 49
ENSDART00000142465 Essential Splice Site 1432 2268 30 49

The following transcripts of ENSDARG00000074635 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 53106281)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAGTTGTTTGTTTTCAWATATTTGTTTGTGTGTGTTTTGTTTGTTACA[G/A]TAGCAGATCGTGTCCGATTAAAGATGGAGAATGGCTGGTTCCAGAGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13007
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051558 Essential Splice Site 1886 2268 40 49
ENSDART00000142465 Essential Splice Site 1886 2268 40 49

The following transcripts of ENSDARG00000074635 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 53111123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTCAGCATCACCGTCCTCATCCARYACCGCTTCTGCATTAAGGCCAG[G/A]TGAGGATACYTTTGTCAATACATTTGTGTGTGTGTGTGTGTGTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4868
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051558 Nonsense 2093 2268 46 49
ENSDART00000142465 Nonsense 2093 2268 46 49

The following transcripts of ENSDARG00000074635 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 53116175)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACCCACCACTGGGATGGACCCCAAAGCACGGCGGGCCCTGTGGAACTG[C/A]ATCCTCAGCATCATTAAAGAGGGACGCTCCGTCGTGCTGACCTCACACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coronary heart disease: Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (View Study)
  • Metabolic syndrome: Genome-wide screen for metabolic syndrome susceptibility Loci reveals strong lipid gene contribution but no evidence for common genetic basis for clustering of metabolic syndrome traits. (View Study)
  • Metabolite levels: Genome-wide association study identifies multiple loci influencing human serum metabolite levels. (View Study)
  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)
  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
  • Total ventricular volume: Genome-wide association with MRI atrophy measures as a quantitative trait locus for Alzheimer's disease. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
  • Triglycerides: Common variants at 30 loci contribute to polygenic dyslipidemia. (View Study)
  • Triglycerides: Genetic variants influencing circulating lipid levels and risk of coronary artery disease. (View Study)
  • Triglycerides: Large-scale genome-wide association studies in East Asians identify new genetic loci influencing metabolic traits. (View Study)
  • Triglycerides: Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts. (View Study)
  • Triglycerides: Newly identified loci that influence lipid concentrations and risk of coronary artery disease. (View Study)
  • Triglycerides: Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/406s19kr