si:dkey-201c1.1

Ensembl ID:
ENSDARG00000074626
ZFIN ID:
ZDB-GENE-081104-353
Human Orthologue:
LRDD
Human Description:
leucine-rich repeats and death domain containing [Source:HGNC Symbol;Acc:16491]
Mouse Orthologue:
Lrdd
Mouse Description:
leucine-rich and death domain containing Gene [Source:MGI Symbol;Acc:MGI:1889507]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1707 Essential Splice Site Available for shipment Available now
sa14411 Essential Splice Site Available for shipment Available now
sa44222 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1707
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110105   None 752 None 17
ENSDART00000144907 Essential Splice Site 486 942 6 15
Genomic Location (Zv9):
Chromosome 25 (position 4743896)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4397596
KASP Assay ID:
554-1653.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGGAAGTGACAAACACAGCTGCAGGCCTGGAGGACGTCCTGCACGGG[T/C]CAGCCAATCAGATCAATCACAGACAAACAACRTATTTCATATTGCTGCTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa14411
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110105 Essential Splice Site 346 752 6 17
ENSDART00000144907 Essential Splice Site 544 942 7 15
Genomic Location (Zv9):
Chromosome 25 (position 4742115)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4395815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTTTCCCTCCAAACTGTACAGCGGAGACGCGCACCGTCACACTGCAG[G/A]TCTGTACAATAATACAGAATTCTGAATTACATGATTCAATATTTGTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110105 Nonsense 431 752 9 17
ENSDART00000144907 Nonsense 629 942 9 15
Genomic Location (Zv9):
Chromosome 25 (position 4739327)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4393027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGGACAGACGTCACCGCTCAAGTGTCCCTGTACGTCACACACATCTA[C/A]GCCGTCTTCTTCATCACACACTTCTCATGGTGAGCAACTGCAAACACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link