si:ch211-198a12.6

Ensembl ID:
ENSDARG00000074624
ZFIN ID:
ZDB-GENE-030131-1683
Description:
hypothetical protein LOC563253 [Source:RefSeq peptide;Acc:NP_001139051]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9995 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9995
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114368   None 359 None 1
ENSDART00000142622 Nonsense 139 524 2 2
Genomic Location (Zv9):
Chromosome 13 (position 18558935)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18378970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACGGTGGAGTCYGAGAATGGTGTTATYATCCATGAGGCTCATGGCCTG[C/T]AGTGCAGCGAGTGTGGCGAGATATTTGGCTGTATGTCAGATCTGCACGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link