im:7150991

Ensembl ID:
ENSDARG00000074617
ZFIN ID:
ZDB-GENE-050809-19
Human Orthologue:
WFS1
Human Description:
Wolfram syndrome 1 (wolframin) [Source:HGNC Symbol;Acc:12762]
Mouse Orthologue:
Wfs1
Mouse Description:
Wolfram syndrome 1 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1328355]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18290 Essential Splice Site Available for shipment Available now
sa17104 Essential Splice Site Available for shipment Available now
sa1914 Nonsense Available for shipment Available now
sa16422 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18290
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112427 Essential Splice Site 235 895 5 7
ENSDART00000112427 Essential Splice Site 235 895 5 7
Genomic Location:
Chromosome 14 (position 15174744)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAATACAGAAACAAAGAAAGATTTTGGAGAGTTTGGTGTCAAGAGATGG[T/C]AAATGCATCATTATCTTTCNCNTTTAGAGTCTGTTTAGTTCTATACYGGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17104
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112427 Essential Splice Site 235 895 5 7
ENSDART00000112427 Essential Splice Site 235 895 5 7
Genomic Location:
Chromosome 14 (position 15174744)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAATACAGAAACAAAGAAAGATTTTGGAGAGTTTGGTGTCAAGAGATGG[T/A]AAATGCATCATTATCTTTCNCNTTTAGAGTCTGTTTAGTTCTATACYGGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112427 Nonsense 253 895 6 7
Genomic Location:
Chromosome 14 (position 15174907)
KASP Assay ID:
554-1904.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATTGCATTGGTGTAGAAGAGTTTGTTGAGAATACCAAACAATACGCT[G/T]AGGGTATTTCACCATCCATGGAAGGGGTAGCAGGGGATGATGATGACGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112427 Nonsense 493 895 7 7
Genomic Location:
Chromosome 14 (position 15179912)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGGTCGTATAATTGGCGGYGCTTGGTTCAGCATGCGCCTTGGTGACTG[G/A]TTGGTAATGCATGTAGGTGTGCCTTGTGTTCTCTATCTCTACCTMYTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/58xyv0h3