si:ch211-113e8.6

Ensembl ID:
ENSDARG00000074610
ZFIN ID:
ZDB-GENE-090313-13
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B7ZDC3]
Human Orthologue:
GIMAP8
Human Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Mouse Orthologue:
Gimap8
Mouse Description:
GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19537 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19537
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020237 Essential Splice Site 434 648 5 5
ENSDART00000133738   None 141 None 2
Genomic Location (Zv9):
Chromosome 1 (position 40576270)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39465679
KASP Assay ID:
2259-0859.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTTGTTCTTAAACAATTCCAGAGCAGCGACATCCATATGAGGAGCTC[A/C]GGATTGTTCTCTTGGGGAAGACTGGAGTTGGGAAAAGTGCAGCTGGAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link