ENSDARG00000074607

Ensembl ID:
ENSDARG00000074607
Mouse Orthologues:
AC135640.1, AC165356.1
Mouse Descriptions:
predicted gene 8989 (Gm8989), non-coding RNA [Source:RefSeq DNA;Acc:NR_030720]
predicted gene 8989 (Gm8989), non-coding RNA [Source:RefSeq DNA;Acc:NR_030720]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1506 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1506
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049593 Nonsense 55 358 1 1
Genomic Location:
Chromosome 3 (position 4573763)
KASP Assay ID:
554-1431.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATCTGTCAGATGAAATGAGATCAAACTGTGAATCACTGAATGGAAAC[A/T]GATCAAATCTTGAGAAACACATCCTGAAGACACTGGCAGAAGAGGAGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/33viqo3o