si:dkey-127k13.2

Ensembl ID:
ENSDARG00000074604
ZFIN ID:
ZDB-GENE-070912-369
Description:
Novel protein similar to vertebrate polyhomeotic homolog 3 (Drosophila) (PHC3) [Source:UniProtKB/TrE
Human Orthologue:
PHC3
Human Description:
polyhomeotic homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:15682]
Mouse Orthologue:
Phc3
Mouse Description:
polyhomeotic-like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2181434]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32966 Nonsense Mutation detected in F1 DNA During 2017
sa19818 Nonsense Available for shipment Available now
sa32967 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6015 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026885 Nonsense 79 893 2 16
ENSDART00000132427 Nonsense 85 96 3 3
ENSDART00000140558   None 173 None 4
Genomic Location (Zv9):
Chromosome 2 (position 37149671)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37446381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATGCAGCTCAACAACAACACATCCTGCTGCAGACAGCAGCGCTACAA[C/T]AGCAACAGCAACATCAACAAAACCTCACCGCTGCACAGATTCTGACAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19818
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026885 Nonsense 81 893 2 16
ENSDART00000132427 Nonsense 87 96 3 3
ENSDART00000140558   None 173 None 4
Genomic Location (Zv9):
Chromosome 2 (position 37149677)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37446387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTCAACAACAACACATCCTGCTGCAGACAGCAGCGCTACAACAGCAA[C/T]AGCAACATCAACAAAACCTCACCGCTGCACAGATTCTGACAACTACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32967
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026885 Essential Splice Site 288 893 None 16
ENSDART00000132427   None 96 None 3
ENSDART00000140558   174 173 None 4
Genomic Location (Zv9):
Chromosome 2 (position 37157773)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37454483
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAACAACGTGACTCAGACACCATCCGCCCAACCAGCCATTCCTCCTTG[T/A]AAGTCACAAAATATATATTTTTTAAATCTATTTAATGGGTTTAATGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026885 Nonsense 892 893 16 16
ENSDART00000132427   None 96 None 3
ENSDART00000140558   None 173 None 4
Genomic Location (Zv9):
Chromosome 2 (position 37168601)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37465311
KASP Assay ID:
554-3686.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAACTGGGACCTGCACTCAAGATCTGTGCGCACATAAATACTCTCAAA[C/T]AAACTTAAGACCGTCACATCCTCCTAAAGTGCCATGATTCCAGTGCATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link