MRVI1

Ensembl ID:
ENSDARG00000074602
Description:
murine retrovirus integration site 1 homolog [Source:HGNC Symbol;Acc:7237]
Human Orthologues:
MRVI1, MRVI1
Human Descriptions:
murine retrovirus integration site 1 homolog [Source:HGNC Symbol;Acc:7237]
murine retrovirus integration site 1 homolog [Source:HGNC Symbol;Acc:7237]
Mouse Orthologue:
Mrvi1
Mouse Description:
MRV integration site 1 Gene [Source:MGI Symbol;Acc:MGI:1338023]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6087 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114427 Essential Splice Site 662 820 18 20
Genomic Location:
Chromosome 7 (position 68702098)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTNTTTTATTGCTCCATCCCTGTCTCTTCTTTCCTATGTGAAACAAAGC[A/G]GTGGAAACCCTCTGACGGAACAGGAAAGTGAAGCAACGCCAACCAAAGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ndhs8e2x