MRVI1

Ensembl ID:
ENSDARG00000074602
Description:
murine retrovirus integration site 1 homolog [Source:HGNC Symbol;Acc:7237]
Human Orthologues:
MRVI1, MRVI1
Human Descriptions:
murine retrovirus integration site 1 homolog [Source:HGNC Symbol;Acc:7237]
murine retrovirus integration site 1 homolog [Source:HGNC Symbol;Acc:7237]
Mouse Orthologue:
Mrvi1
Mouse Description:
MRV integration site 1 Gene [Source:MGI Symbol;Acc:MGI:1338023]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41071 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6087 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41071
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114427 Essential Splice Site 600 820 15 20
Genomic Location:
Chromosome 7 (position 68693653)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGGTGTTCCACGCTCATCAAGATCCATGTCTATGCAAATGGGAAAG[G/A]TAGGCCAATATCCCAGGAAAAACCTTATATTATAGGTTATGTACACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114427 Essential Splice Site 662 820 18 20
Genomic Location:
Chromosome 7 (position 68702098)
KASP Assay ID:
554-3688.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTNTTTTATTGCTCCATCCCTGTCTCTTCTTTCCTATGTGAAACAAAGC[A/G]GTGGAAACCCTCTGACGGAACAGGAAAGTGAAGCAACGCCAACCAAAGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link