lzts2

Ensembl ID:
ENSDARG00000074597
ZFIN ID:
ZDB-GENE-090313-276
Description:
leucine zipper, putative tumor suppressor 2 [Source:RefSeq peptide;Acc:NP_001139078]
Human Orthologues:
LZTS1, N4BP3, RP5-1187M17.10
Human Descriptions:
leucine zipper, putative tumor suppressor 1 [Source:HGNC Symbol;Acc:13861]
NEDD4 binding protein 3 [Source:HGNC Symbol;Acc:29852]
ProSAP-interacting protein 1 [Source:UniProtKB/Swiss-Prot;Acc:O60299]
Mouse Orthologues:
Lzts1, N4bp3, Prosapip1
Mouse Descriptions:
leucine zipper, putative tumor suppressor 1 Gene [Source:MGI Symbol;Acc:MGI:2684762]
NEDD4 binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:2442218]
ProSAPiP1 protein Gene [Source:MGI Symbol;Acc:MGI:2656976]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35459 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109277 Splice Site None 709 None 4
ENSDART00000146795 Nonsense 392 741 4 5
ENSDART00000147579   None 132 None 2
Genomic Location (Zv9):
Chromosome 13 (position 18851198)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18671233
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGAAATTATCATACACGATACAACTTAAATCATCTGTATTCTCAATG[C/T]AGGTGTATGAGGAGAAACAGAAGCGCTGTGAGCAAGAAATGGAGGATCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link