eda

Ensembl ID:
ENSDARG00000074591
ZFIN ID:
ZDB-GENE-050107-6
Description:
ectodysplasin-A [Source:RefSeq peptide;Acc:NP_001108537]
Human Orthologue:
EDA
Human Description:
ectodysplasin A [Source:HGNC Symbol;Acc:3157]
Mouse Orthologue:
Eda
Mouse Description:
ectodysplasin-A Gene [Source:MGI Symbol;Acc:MGI:1195272]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3533 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31463 Nonsense Mutation detected in F1 DNA During 2016
sa31464 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa3533
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102973 Essential Splice Site 128 359 3 8
ENSDART00000103020 Essential Splice Site 128 359 3 8
ENSDART00000145301 Essential Splice Site 128 360 3 8
Genomic Location:
Chromosome 5 (position 38094433)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATACATTTCCAACTGATTGTCTTTCTTCCTTCTGCTTATTCCTCATCC[A/T]GAAACTAATGGAAAAAAGAAAGGCGAGCGAAAAAAAGGTAATTTCATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31463
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102973 Nonsense 142 359 4 8
ENSDART00000103020 Nonsense 142 359 4 8
ENSDART00000145301 Nonsense 142 360 4 8
Genomic Location:
Chromosome 5 (position 38094630)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGACTGATCTTGCTTTCCTTTCTCTCTCTCTTTATGTCTTTAGGCAAG[A/T]AAGGGCCCCCTGGTGCTCCTGGACCTCCGGGGCCACCTGGTCCACAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31464
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102973 Nonsense 299 359 8 8
ENSDART00000103020 Nonsense 299 359 8 8
ENSDART00000145301 Nonsense 300 360 8 8
Genomic Location:
Chromosome 5 (position 38098986)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCAGTTACGAGGTGATGGTGGACAAAACTCCGTTCTTACGCTGCACC[A/T]GAAGCATCGAAACCGGCCAGCGCAAGTTCAACACCTGCTACACAGCCGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link