eda

Ensembl ID:
ENSDARG00000074591
ZFIN ID:
ZDB-GENE-050107-6
Description:
ectodysplasin-A [Source:RefSeq peptide;Acc:NP_001108537]
Human Orthologue:
EDA
Human Description:
ectodysplasin A [Source:HGNC Symbol;Acc:3157]
Mouse Orthologue:
Eda
Mouse Description:
ectodysplasin-A Gene [Source:MGI Symbol;Acc:MGI:1195272]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31463 Nonsense Mutation detected in F1 DNA During 2016
sa31464 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31463
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102973 Nonsense 142 359 4 8
ENSDART00000103020 Nonsense 142 359 4 8
ENSDART00000145301 Nonsense 142 360 4 8
Genomic Location (Zv9):
Chromosome 5 (position 38094630)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35894314
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGACTGATCTTGCTTTCCTTTCTCTCTCTCTTTATGTCTTTAGGCAAG[A/T]AAGGGCCCCCTGGTGCTCCTGGACCTCCGGGGCCACCTGGTCCACAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31464
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102973 Nonsense 299 359 8 8
ENSDART00000103020 Nonsense 299 359 8 8
ENSDART00000145301 Nonsense 300 360 8 8
Genomic Location (Zv9):
Chromosome 5 (position 38098986)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35898670
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCAGTTACGAGGTGATGGTGGACAAAACTCCGTTCTTACGCTGCACC[A/T]GAAGCATCGAAACCGGCCAGCGCAAGTTCAACACCTGCTACACAGCCGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link