C2orf86

Ensembl ID:
ENSDARG00000074590
Description:
chromosome 2 open reading frame 86 [Source:HGNC Symbol;Acc:28027]
Human Orthologue:
C2orf86
Human Description:
chromosome 2 open reading frame 86 [Source:HGNC Symbol;Acc:28027]
Mouse Orthologue:
AV249152
Mouse Description:
expressed sequence AV249152 Gene [Source:MGI Symbol;Acc:MGI:2144467]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23077 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13922 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112665 Essential Splice Site 180 707 7 17
Genomic Location:
Chromosome 17 (position 24221479)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGATCTAGCAAGACACATGGAGAAACTCACAGCTGCAGAGATTAAGG[T/G]AACACACACACACACACACACACACACATACCTCTTACACACATCTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13922
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112665 Nonsense 346 707 9 17
Genomic Location:
Chromosome 17 (position 24192707)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGGGTTGTYCWGGGGCTTCAAGATTGCTCTGTGGTTCWTTTCGACCCA[C/T]AGACAGGMCTCTCCCAGTGGGCCACTTGCTCCATGATGCCGGCGGTGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nhbimjqe