C2orf86

Ensembl ID:
ENSDARG00000074590
Description:
chromosome 2 open reading frame 86 [Source:HGNC Symbol;Acc:28027]
Human Orthologue:
C2orf86
Human Description:
chromosome 2 open reading frame 86 [Source:HGNC Symbol;Acc:28027]
Mouse Orthologue:
AV249152
Mouse Description:
expressed sequence AV249152 Gene [Source:MGI Symbol;Acc:MGI:2144467]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23077 Essential Splice Site Available for shipment Available now
sa13922 Nonsense Available for shipment Available now
sa39162 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23077
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112665 Essential Splice Site 180 707 7 17
Genomic Location (Zv9):
Chromosome 17 (position 24221479)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24374921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGATCTAGCAAGACACATGGAGAAACTCACAGCTGCAGAGATTAAGG[T/G]AACACACACACACACACACACACACACATACCTCTTACACACATCTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13922
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112665 Nonsense 346 707 9 17
Genomic Location (Zv9):
Chromosome 17 (position 24192707)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24346149
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGGGTTGTYCWGGGGCTTCAAGATTGCTCTGTGGTTCWTTTCGACCCA[C/T]AGACAGGMCTCTCCCAGTGGGCCACTTGCTCCATGATGCCGGCGGTGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112665 Nonsense 470 707 10 17
Genomic Location (Zv9):
Chromosome 17 (position 24181683)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24335125
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGTGTTCTATGTGCAGGTGTGTTTAATGGTGCTCAGCTTGGCCCATG[T/A]GATCTGATACTGCACCGTCTGCTCTGTGAGGAGGTAGATGCAGCTCTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link