si:dkey-15f17.8

Ensembl ID:
ENSDARG00000074588
ZFIN ID:
ZDB-GENE-090313-192
Description:
hypothetical protein LOC796750 [Source:RefSeq peptide;Acc:NP_001139089]
Human Orthologue:
C1orf156
Human Description:
chromosome 1 open reading frame 156 [Source:HGNC Symbol;Acc:28793]
Mouse Orthologue:
2810422O20Rik
Mouse Description:
RIKEN cDNA 2810422O20 gene Gene [Source:MGI Symbol;Acc:MGI:1917212]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10781 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111477 Nonsense 272 321 2 2
ENSDART00000137291   226 225 3 3
Genomic Location (Zv9):
Chromosome 13 (position 31615065)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31261013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCATAGCGTGTTTACTGATCTGCTTGACAGGAAYGGAAATGTTTATT[T/A]AGCAACAAAGTCTCATTATTTTGGAGTAGGAGGTGGCCTTCATATGTTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link