ENSDARG00000074585

Ensembl ID:
ENSDARG00000074585
Human Orthologue:
PACS1
Human Description:
phosphofurin acidic cluster sorting protein 1 [Source:HGNC Symbol;Acc:30032]
Mouse Orthologue:
Pacs1
Mouse Description:
phosphofurin acidic cluster sorting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1277113]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10795 Essential Splice Site Available for shipment Available now
sa17470 Nonsense Available for shipment Available now
sa42315 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065421 Essential Splice Site 68 883 4 31
Genomic Location:
Chromosome 13 (position 53953332)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACGTAWATGCATGTGTGTGTGTATCTGGTTTAATGTGTSGSTTTGTGTG[T/A]GCAGGGCTCCAAACGAGTGCTGCGGTCAAAYGAGTATGCTCTTCCTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065421 Nonsense 616 883 23 31
Genomic Location:
Chromosome 13 (position 53966327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCATTMGACAGTAAGTTCAGCAGCATGTTCATGGAGCCATCGTGGAGG[G/T]AGCTGTTCTGCCGGCCAGAACCCCCGAACACAGGTACAGCTAATGAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42315
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065421 Essential Splice Site 626 883 23 31
Genomic Location:
Chromosome 13 (position 53966361)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGCCATCGTGGAGGGAGCTGTTCTGCCGGCCAGAACCCCCGAACACAG[G/A]TACAGCTAATGAGTGTGATGCTGATAAACAGAGGTTTTGTGTGTGTGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link