ENSDARG00000074585

Ensembl ID:
ENSDARG00000074585
Human Orthologue:
PACS1
Human Description:
phosphofurin acidic cluster sorting protein 1 [Source:HGNC Symbol;Acc:30032]
Mouse Orthologue:
Pacs1
Mouse Description:
phosphofurin acidic cluster sorting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1277113]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10795 Essential Splice Site Available for shipment Available now
sa17470 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065421 Essential Splice Site 68 883 4 31
Genomic Location:
Chromosome 13 (position 53953332)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACGTAWATGCATGTGTGTGTGTATCTGGTTTAATGTGTSGSTTTGTGTG[T/A]GCAGGGCTCCAAACGAGTGCTGCGGTCAAAYGAGTATGCTCTTCCTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065421 Nonsense 616 883 23 31
Genomic Location:
Chromosome 13 (position 53966327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCATTMGACAGTAAGTTCAGCAGCATGTTCATGGAGCCATCGTGGAGG[G/T]AGCTGTTCTGCCGGCCAGAACCCCCGAACACAGGTACAGCTAATGAGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/37oxwne5