LOC793756

Ensembl ID:
ENSDARG00000074583
Human Orthologue:
GRID1
Human Description:
glutamate receptor, ionotropic, delta 1 [Source:HGNC Symbol;Acc:4575]
Mouse Orthologue:
Grid1
Mouse Description:
glutamate receptor, ionotropic, delta 1 Gene [Source:MGI Symbol;Acc:MGI:95812]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19177 Nonsense Mutation detected in F1 DNA During 2014
sa1480 Nonsense Available for shipment Available now
sa17037 Nonsense Available for shipment Available now
sa19178 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4017 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19177
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087084 Nonsense 293 929 5 14
Genomic Location:
Chromosome 17 (position 26140415)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAGTCAACAAAGCCCTGGAATGGAGGCTGGTCCATGCTGGACACCATC[C/T]AAAAGGTCTAAAGTCACTTTACAATTCATCTCACTTAGATCTAATTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1480
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087084 Nonsense 449 929 9 14
Genomic Location:
Chromosome 17 (position 26172915)
KASP Assay ID:
554-1405.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATTTAGCGAGCAGATGTGGCTATTTCAGCCATCACCATCACTCCAGAA[C/T]GAGAAAACGTAGTGGACTTCAGTAAACGTTATCTGGATTATTCAGTGGGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa17037
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087084 Nonsense 673 929 12 14
Genomic Location:
Chromosome 17 (position 26193973)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAAGCGGGATCCATACGCTTTYCTGTGGGACATGGCGGTGTTAGAGTA[T/A]GCAGCTCTGACAGATGATGATTGTACGCTGGTGGTCACTGGAAACGGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19178
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087084 Essential Splice Site 712 929 12 14
ENSDART00000087084 Essential Splice Site 712 929 12 14
Genomic Location:
Chromosome 17 (position 26194090)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCTGGCTCTGCAGCATGGCAGCCCCTACAGAGACCTCTTCTCGCAGAA[G/T]TGAGCACCTCCCTTCATAGCGATACAAGTCGTTAAAGAAGCTGAAGGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087084 Essential Splice Site 712 929 12 14
ENSDART00000087084 Essential Splice Site 712 929 12 14
Genomic Location:
Chromosome 17 (position 26194090)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCTGGCTCTGCAGCATGGCAGCCCCTACAGAGACCTCTTCTCGCAGAA[G/T]TGAGCACYTCCCTTCATAGCGATACWAGTCGTTAAAGMAGCTGAAGGATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/na0rnww9