LOC565651

Ensembl ID:
ENSDARG00000074582
Human Orthologues:
AC144571.1, GFRA1, GFRA2, GFRA3
Human Descriptions:
GDNF family receptor alpha 1 [Source:HGNC Symbol;Acc:4243]
GDNF family receptor alpha 2 [Source:HGNC Symbol;Acc:4244]
GDNF family receptor alpha 3 [Source:HGNC Symbol;Acc:4245]
Mouse Orthologues:
Gfra1, Gfra2, Gfra3
Mouse Descriptions:
glial cell line derived neurotrophic factor family receptor alpha 1 Gene [Source:MGI Symbol;Acc:MGI:
glial cell line derived neurotrophic factor family receptor alpha 2 Gene [Source:MGI Symbol;Acc:MGI:
glial cell line derived neurotrophic factor family receptor alpha 3 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12119 Nonsense Available for shipment Available now
sa22469 Nonsense Mutation detected in F1 DNA During 2014
sa7743 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12119
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108987 Nonsense 123 431 3 8
Genomic Location:
Chromosome 14 (position 23685937)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCTTAACCTGGTAGAGAACTATCCGTATGAAACAGTGGAGAAAGGCTA[T/A]GAGTTTGTCCGTCTGGCTTCCATCACTGCAGGTAAGGTAATAGCTTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22469
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108987 Nonsense 165 431 4 8
Genomic Location:
Chromosome 14 (position 23692651)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAAAGCTTGCAACATTGATGACGTTTGCCAGAGACTGCGCACCGAGTA[T/A]GTGTCAACATGCATCAAGCCCTCCACCAAATCGGGTTTGTGTAACCGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108987 Essential Splice Site 386 431 8 8
Genomic Location:
Chromosome 14 (position 23710660)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGAAACCAAATTGCCATTATTAAAAATGCTTTCTTGTCTTGTTCTTCA[G/T]GACTCTGTGAAGGTGAGACTTTGGTCTGACTCCACCCCGTCCTTCGACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5h64a8s6