add2

Ensembl ID:
ENSDARG00000074581
ZFIN ID:
ZDB-GENE-080718-4
Description:
Novel protein similar to vertebrate adducin 2 (Beta) (ADD2) [Source:UniProtKB/TrEMBL;Acc:A2BFZ3]
Human Orthologue:
ADD2
Human Description:
adducin 2 (beta) [Source:HGNC Symbol;Acc:244]
Mouse Orthologue:
Add2
Mouse Description:
adducin 2 (beta) Gene [Source:MGI Symbol;Acc:MGI:87919]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20359 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014
sa13879 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20359
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114841 Missense 264 670 6 14
ENSDART00000148297 Essential Splice Site 210 462 None 10
Genomic Location:
Chromosome 5 (position 15009443)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGCCTTTTACACAATCTACCACATCCAGACCGCCTGTCAAATACAGG[T/C]AGGCAAAAAAAAAATGAAATTGAAAAGCTTCTCATTTGGACAAAATGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114841 Essential Splice Site 583 670 14 14
ENSDART00000148297 None None 462 None 10
Genomic Location:
Chromosome 5 (position 14991992)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCTTTTACTATTTCTTTTGCATTTTTATTTCAATTGCATTCGCATAC[A/T]GATGAAAAAACTRCAGAKGCTGTTCAAAAYGATAAAGGYGATGAGAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ne4j7ijt