gab2

Ensembl ID:
ENSDARG00000074577
Human Orthologues:
GAB2, GAB4
Human Descriptions:
GRB2-associated binding protein 2 [Source:HGNC Symbol;Acc:14458]
GRB2-associated binding protein family, member 4 [Source:HGNC Symbol;Acc:18325]
Mouse Orthologue:
Gab2
Mouse Description:
growth factor receptor bound protein 2-associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:1333854]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10243 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10243
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113515 Essential Splice Site 620 666 10 10
Genomic Location:
Chromosome 15 (position 21817919)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGTCAGAATTGTATTTGCGAAATCTATACCCTTTATTTTCTCTCTTAC[A/T]GCCGTCCACCTCTTCAGTCACCTCAGATGAAAAAGTGGACTATGTGCAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8lk3tis0