LOC555496

Ensembl ID:
ENSDARG00000074571
Human Orthologue:
GPAA1
Human Description:
glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) [Source:HGNC Symbol;Acc:444
Mouse Orthologue:
Gpaa1
Mouse Description:
GPI anchor attachment protein 1 Gene [Source:MGI Symbol;Acc:MGI:1202392]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44521 Nonsense Mutation detected in F1 DNA During 2017
sa1091 Nonsense F2 line generated During 2017
sa2042 Nonsense Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa44521
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114431 Nonsense 137 615 4 12
Genomic Location (Zv9):
Chromosome 2 (position 2485052)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTCAGATGGTTCGGGGCACAAATGTTTATGGGATTTTGCGAGCGCCT[C/T]GAGCTCCTCGGACAGAAGCGCTCGTGATCAGCGCCCCCTGCACTCCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1091
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114431 Nonsense 388 615 8 12
Genomic Location (Zv9):
Chromosome 2 (position 2479523)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2347175
KASP Assay ID:
554-0993.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGCTACTACATGCCAGCGTTTGGCCTGCTGGCGGTCATCTTACTGCTC[C/T]GAGTATCCATTTCAGTCCAACTGTGTTTACCTTCTTTACTATTATTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2042
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114431 Nonsense 605 615 12 12
Genomic Location (Zv9):
Chromosome 2 (position 2472997)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2340649
KASP Assay ID:
554-2785.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACGGGTCGCTCGTCTATCCGCTTTTAGCGCTGTTCGTTTATCCCTGCTG[G/A]CTGATGTTCTGGAATATTCTCTTCTGGAAGTAAACAAGTGAAAGAGCAAA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076
aplastic
PATO:0001483
abnormal
PATO:0000460
mRNA Expression Profiling Preview:
View complete mRNA expression profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
18:12656301-12657213 12657213 1 1.83 × 10-21 -1.0 0 tat ENSDARG00000069630
1:57116382-57117200 57116382 -1 4.17 × 10-18 0.8 0 wu:fa03e10 ENSDARG00000088636
2:31480049-31480900 31480049 -1 1.52 × 10-15 1.0 0 and2 ENSDARG00000079302
20:46803313-46803700 46803313 -1 3.55 × 10-15 -2.8 -5 fos ENSDARG00000031683
16:26161401-26162254 26162254 1 4.15 × 10-15 2.4 93 APOA4 (4 of 4) ENSDARG00000094929

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link