LOC555496

Ensembl ID:
ENSDARG00000074571
Human Orthologue:
GPAA1
Human Description:
glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) [Source:HGNC Symbol;Acc:444
Mouse Orthologue:
Gpaa1
Mouse Description:
GPI anchor attachment protein 1 Gene [Source:MGI Symbol;Acc:MGI:1202392]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1091 Nonsense F2 line generated During 2014
sa2042 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa1091
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114431 Nonsense 388 615 8 12
Genomic Location:
Chromosome 2 (position 2479523)
KASP Assay ID:
554-0993.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGCTACTACATGCCAGCGTTTGGCCTGCTGGCGGTCATCTTACTGCTC[C/T]GAGTATCCATTTCAGTCCAACTGTGTTTACCTTCTTTACTATTATTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2042
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114431 Nonsense 605 615 12 12
Genomic Location:
Chromosome 2 (position 2472997)
KASP Assay ID:
554-2785.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACGGGTCGCTCGTCTATCCGCTTTTAGCGCTGTTCGTTTATCCCTGCTG[G/A]CTGATGTTCTGGAATATTCTCTTCTGGAAGTAAACAAGTGAAAGAGCAAA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076
aplastic
PATO:0001483
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
18:12656301-12657213 12657213 1 1.83 × 10-21 -1.0 0 tat ENSDARG00000069630
1:57116382-57117200 57116382 -1 4.17 × 10-18 0.8 0 wu:fa03e10 ENSDARG00000088636
2:31480049-31480900 31480049 -1 1.52 × 10-15 1.0 0 and2 ENSDARG00000079302
20:46803313-46803700 46803313 -1 3.55 × 10-15 -2.8 -5 fos ENSDARG00000031683
16:26161401-26162254 26162254 1 4.15 × 10-15 2.4 93 APOA4 (4 of 4) ENSDARG00000094929

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a7rcvark