LOC555828

Ensembl ID:
ENSDARG00000074565
Human Orthologue:
PUSL1
Human Description:
pseudouridylate synthase-like 1 [Source:HGNC Symbol;Acc:26914]
Mouse Orthologue:
Pusl1
Mouse Description:
pseudouridylate synthase-like 1 Gene [Source:MGI Symbol;Acc:MGI:3047787]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10331 Essential Splice Site Available for shipment Available now
sa7659 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3793 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10331
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113096 Essential Splice Site 204 280 5 7
ENSDART00000113096 Essential Splice Site 204 280 5 7
Genomic Location:
Chromosome 11 (position 3576368)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGCCCAGCTGGAGCCTGGAGAATCATTCTCTCAGAGACACTTTCAAAG[G/A]TAYGACTCAYAAGTGGAGTGGGAAGACACCAAAAYAAGATATTWAGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113096 Essential Splice Site 204 280 5 7
ENSDART00000113096 Essential Splice Site 204 280 5 7
Genomic Location:
Chromosome 11 (position 3576368)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGCCCAGCTGGAGCCTGGAGAATCATTCTCTCAGAGACACTTTCAAAG[G/A]TAYGACTCAYAAGTGGAGTGGGAAGACACCAAAAYAAGATATTWAGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3793
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113096 Nonsense 253 280 7 7
Genomic Location:
Chromosome 11 (position 3582766)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGACTTTCTGTAAGTAAGATACARGATCTATTAGAGGCGCGTGATTCRT[T/A]GGCATTCCCAAAYAACCTGACGGCCCCAGCCCATGGMCTGTTTCTGACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1sggugom