LOC555828

Ensembl ID:
ENSDARG00000074565
Human Orthologue:
PUSL1
Human Description:
pseudouridylate synthase-like 1 [Source:HGNC Symbol;Acc:26914]
Mouse Orthologue:
Pusl1
Mouse Description:
pseudouridylate synthase-like 1 Gene [Source:MGI Symbol;Acc:MGI:3047787]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10331 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10331
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113096 Essential Splice Site 204 280 5 7
ENSDART00000113096 Essential Splice Site 204 280 5 7
Genomic Location (Zv9):
Chromosome 11 (position 3576368)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3494872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGCCCAGCTGGAGCCTGGAGAATCATTCTCTCAGAGACACTTTCAAAG[G/A]TAYGACTCAYAAGTGGAGTGGGAAGACACCAAAAYAAGATATTWAGCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link