GPR37 (1 of 2)

Ensembl ID:
ENSDARG00000074563
Description:
G protein-coupled receptor 37 (endothelin receptor type B-like) [Source:HGNC Symbol;Acc:4494]
Human Orthologue:
GPR37
Human Description:
G protein-coupled receptor 37 (endothelin receptor type B-like) [Source:HGNC Symbol;Acc:4494]
Mouse Orthologue:
Gpr37
Mouse Description:
G protein-coupled receptor 37 Gene [Source:MGI Symbol;Acc:MGI:1313297]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18466 Nonsense Available for shipment Available now
sa6000 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112299 Nonsense 425 558 2 2
Genomic Location:
Chromosome 25 (position 28366207)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCAYGTAAGATCCGCAAAGCCGAGCGTGCCAGTGTTCGGGGCAATCGC[A/T]AACAGATCCAACTTGAAAGCCAAATGAACTGCATTGTGGTCGCCTTAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6000
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112299 Nonsense 483 558 2 2
Genomic Location:
Chromosome 25 (position 28366383)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCGCACACTAGATATCCTTCATCTAGTCAGTCAAATGATGCTGTTCTG[C/A]AAGTCTGCTGTCACACCCGTGCTGCTTCTTGCACTCTGTCGGCCATTTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ip18xzvl