ENSDARG00000074561

Ensembl ID:
ENSDARG00000074561
Human Orthologues:
SLC47A1, SLC47A2
Human Descriptions:
solute carrier family 47, member 1 [Source:HGNC Symbol;Acc:25588]
solute carrier family 47, member 2 [Source:HGNC Symbol;Acc:26439]
Mouse Orthologues:
Slc47a1, Slc47a2
Mouse Descriptions:
solute carrier family 47, member 1 Gene [Source:MGI Symbol;Acc:MGI:1914723]
solute carrier family 47, member 2 Gene [Source:MGI Symbol;Acc:MGI:3588190]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14509 Nonsense Available for shipment Available now
sa22656 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110150 Nonsense 1 538 1 18
Genomic Location:
Chromosome 15 (position 25937142)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCSTCAGNNNGATGAACGAAAGAATGAACGAAGCAGAAAACTCYTCCAGATG[T/A]GGATGGTGCTCTAGGTGTTTTAGTTTTTTACCAGTGGACTATACGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110150 Nonsense 245 538 9 18
Genomic Location:
Chromosome 15 (position 25942900)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTAGGTTGGTCGATGGACTGCTTGCAGGAATGGGACTCGTTCATTTA[T/A]TTGGCCATTCCCAGTATGCTCATGATGTGTGGAGAGTGGTGGACCTATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/www8677q