LOC100331516

Ensembl ID:
ENSDARG00000074556
Human Orthologue:
GANC
Human Description:
glucosidase, alpha; neutral C [Source:HGNC Symbol;Acc:4139]
Mouse Orthologue:
Ganc
Mouse Description:
glucosidase, alpha; neutral C Gene [Source:MGI Symbol;Acc:MGI:1923301]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7842 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9837 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109532 Essential Splice Site 417 898 11 24
Genomic Location:
Chromosome 17 (position 45457239)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCRAATCCAGCAGAACTWCAGCATCATCTCATGAAGAAGAAMAGRAAG[G/A]TATAGTAGTGGATTATGTAAGATAACYAGTATAGTTGTTTAATACAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9837
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109532 Nonsense 886 898 24 24
Genomic Location:
Chromosome 17 (position 45469619)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCATGTTTGARTTTGACAAAAAACGAGGCGTATTAACATTAAGTRGTT[T/A]GGAACTTGAAATATGCAAAGACTGGGAAATAATAATATAGCCATGGTGNNNNNNNNNNNNNNNNTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h300hrre