LOC100331516

Ensembl ID:
ENSDARG00000074556
Human Orthologue:
GANC
Human Description:
glucosidase, alpha; neutral C [Source:HGNC Symbol;Acc:4139]
Mouse Orthologue:
Ganc
Mouse Description:
glucosidase, alpha; neutral C Gene [Source:MGI Symbol;Acc:MGI:1923301]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7842 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36510 Nonsense Mutation detected in F1 DNA During 2016
sa9837 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109532 Essential Splice Site 417 898 11 24
Genomic Location:
Chromosome 17 (position 45457239)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCRAATCCAGCAGAACTWCAGCATCATCTCATGAAGAAGAAMAGRAAG[G/A]TATAGTAGTGGATTATGTAAGATAACYAGTATAGTTGTTTAATACAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36510
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109532 Nonsense 666 898 17 24
Genomic Location:
Chromosome 17 (position 45462121)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCGATCCGCTCTGCTGTTCAGGACAGATACTGTCTTCTGCCGTACTG[G/A]TACACACTGTTTCACCAGGCACACACAGCTGCACTTCCACCTATCAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9837
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109532 Nonsense 886 898 24 24
Genomic Location:
Chromosome 17 (position 45469619)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCATGTTTGARTTTGACAAAAAACGAGGCGTATTAACATTAAGTRGTT[T/A]GGAACTTGAAATATGCAAAGACTGGGAAATAATAATATAGCCATGGTGNNNNNNNNNNNNNNNNTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link