LOC565691

Ensembl ID:
ENSDARG00000074551
Human Orthologue:
KCNT2
Human Description:
potassium channel, subfamily T, member 2 [Source:HGNC Symbol;Acc:18866]
Mouse Orthologue:
Kcnt2
Mouse Description:
potassium channel, subfamily T, member 2 Gene [Source:MGI Symbol;Acc:MGI:3036273]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25260 Nonsense Mutation detected in F1 DNA During 2015
sa11833 Nonsense Available for shipment Available now
sa26142 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa25260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110065 Nonsense 781 1195 24 33
Genomic Location:
Chromosome 3 (position 48115900)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCTTTCTTTCACTAGACCTGAGGCAGACTTCTTGGAGGCCATCTGCTG[G/A]TTTCCTATGGTCTTTTACACAGTGGGCTCCATTGACAAGTAAGACTAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11833
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110065 Nonsense 1051 1195 30 33
Genomic Location:
Chromosome 3 (position 48111696)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCCATGGAYCACCCTYTACTGAGGAGGAAGAGCATGCAGTGGGCACGA[C/T]GACTRAGTCGTAAGAGTGGACGAGGATCCGGCGGGGCGAAGGGAGTGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26142
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110065 Essential Splice Site 1127 1195 32 33
Genomic Location:
Chromosome 3 (position 48108951)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTAGAGATATTAAGTTGGTCTAAATTATAGTTTTGTACCCTCTGCTTA[T/A]GTCAGATGGGATGACAGACCAGGGCAACAGACTGTCCTATATTCTTATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7lbds58i