si:dkey-179j5.5

Ensembl ID:
ENSDARG00000074538
ZFIN ID:
ZDB-GENE-070705-320
Description:
hypothetical protein LOC100007187 [Source:RefSeq peptide;Acc:NP_001098618]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29798 Nonsense Mutation detected in F1 DNA During 2017
sa24184 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa29798
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102751 Nonsense 43 127 3 6
ENSDART00000125831 Nonsense 75 159 3 5
Genomic Location (Zv9):
Chromosome 22 (position 25464354)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24964260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCAGACGTCGTAACTGCATGCGAGGGGTTTCTCCTGTATCTGACCTG[T/A]CCAAGTAAGATGAAGCGTCAATCTACTAAAGCTCTTGACTACATAATACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24184
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102751 Essential Splice Site 89 127 4 6
ENSDART00000125831 Essential Splice Site 121 159 4 5
Genomic Location (Zv9):
Chromosome 22 (position 25464075)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24963981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACACCAACTGCTATTCTCCTCACGCACTGCACATTGTGTCAGAAAGG[T/C]ATAGATTACAGCAATTTGCTTTATAATTCTAATACTTGGGCTTATTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link