S238B_DANRE

Ensembl ID:
ENSDARG00000074533
Description:
Solute carrier family 25 member 38-B [Source:UniProtKB/Swiss-Prot;Acc:P0CAT2]
Human Orthologue:
SLC25A38
Human Description:
solute carrier family 25, member 38 [Source:HGNC Symbol;Acc:26054]
Mouse Orthologue:
Slc25a38
Mouse Description:
solute carrier family 25, member 38 Gene [Source:MGI Symbol;Acc:MGI:2384782]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20631 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20631
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129189 Essential Splice Site 41 323 1 7
Genomic Location (Zv9):
Chromosome 6 (position 7650993)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 7577009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTCTGTGCAAACTTCATCATCATCCTCTGCAATGGAAGTTGCCCTGG[T/C]GAGTCTGTGCTCTTTAAGTTTTCTTTAAATGAAGGTTGTTTCAACAGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link