LOC565523

Ensembl ID:
ENSDARG00000074527
Human Orthologue:
CHST15
Human Description:
carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 [Source:HGNC Symbol;Acc:18137
Mouse Orthologue:
Chst15
Mouse Description:
carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 Gene [Source:MGI Symbol;Acc:M

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36390 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36390
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085076 Essential Splice Site 142 518 1 7
Genomic Location (Zv9):
Chromosome 17 (position 21378155)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21528304
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTAGACGAGTGCCTGACCTGGGAGAAGTGAGAGAGAAAGAGCCAAATG[T/G]ATGTGCATTTCAGTTACATTGCTAATAATATTTATTTTGTTTAACAATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link