LOC569773

Ensembl ID:
ENSDARG00000074526
Human Orthologue:
ZBTB16
Human Description:
zinc finger and BTB domain containing 16 [Source:HGNC Symbol;Acc:12930]
Mouse Orthologue:
Zbtb16
Mouse Description:
zinc finger and BTB domain containing 16 Gene [Source:MGI Symbol;Acc:MGI:103222]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12417 Nonsense Available for shipment Available now
sa35853 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12417
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114159 Nonsense 84 659 1 6
Genomic Location:
Chromosome 15 (position 17302653)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACATTACACTCTGGACTTCCTCTCACCAAAGACCTTCCAGCAGATTT[T/A]GGAGTACGCCTACACYGCCACGCTCCAAGCCAAGCTGGARGACCTGGAYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114159 Nonsense 329 659 1 6
Genomic Location:
Chromosome 15 (position 17301919)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATAGACATTTCGCTTCGCTGTGCTCCATCCCGTCCAACCATAAGAGC[G/T]AAAGCATGCTGCCCGTGCCTGTGTCCATGGCCTCGTCCCTACATGTGCCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link