CNTNAP1

Ensembl ID:
ENSDARG00000074524
Description:
contactin associated protein 1 [Source:HGNC Symbol;Acc:8011]
Human Orthologue:
CNTNAP1
Human Description:
contactin associated protein 1 [Source:HGNC Symbol;Acc:8011]
Mouse Orthologue:
Cntnap1
Mouse Description:
contactin associated protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:1858201]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12772 Nonsense Available for shipment Available now
sa26120 Nonsense Mutation detected in F1 DNA During 2016
sa31346 Missense Mutation detected in F1 DNA During 2016
sa3434 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111981 Nonsense 180 1292 4 23
Genomic Location:
Chromosome 3 (position 36924443)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGCATACTCGTTCCCGCGGGGCAGAATGARGACACTCCAGGACCACTA[T/A]GCTCTGAAYTTTAAGACACTGGAGAAGGACGGTATTTTACTGCACAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26120
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111981 Nonsense 283 1292 6 23
Genomic Location:
Chromosome 3 (position 36922657)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTAAGTCATTACTTAAATGTTCCCCAAATTATTTTTCTTTAGATTTA[T/A]GTTGGTGGTGTGATTGAGAAAGACATGCCACACCTGCCCGGTAAGGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111981 Missense 522 1292 9 23
Genomic Location:
Chromosome 3 (position 36918648)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGCTGCAGAGGAAATGGGGCAGATATGCAGAAATCCTGCTGGGCACC[T/A]GCGGGATCACTGATAGGTAAGTGTGTGTTTGGGTGTGTGGGTTTTGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3434
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111981 Nonsense 583 1292 11 23
Genomic Location:
Chromosome 3 (position 36918179)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTCATGTGAGGCCTACAGACTCAATGGAAAATAYTGGTCAGGCAACTA[C/A]ACCATAGACCCAGATCTGAGCGGACCACTGAAGCCTTTYACCGTCTACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link