CNTNAP1

Ensembl ID:
ENSDARG00000074524
Description:
contactin associated protein 1 [Source:HGNC Symbol;Acc:8011]
Human Orthologue:
CNTNAP1
Human Description:
contactin associated protein 1 [Source:HGNC Symbol;Acc:8011]
Mouse Orthologue:
Cntnap1
Mouse Description:
contactin associated protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:1858201]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12772 Nonsense Available for shipment Available now
sa3434 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111981 Nonsense 180 1292 4 23
Genomic Location:
Chromosome 3 (position 36924443)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGCATACTCGTTCCCGCGGGGCAGAATGARGACACTCCAGGACCACTA[T/A]GCTCTGAAYTTTAAGACACTGGAGAAGGACGGTATTTTACTGCACAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3434
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111981 Nonsense 583 1292 11 23
Genomic Location:
Chromosome 3 (position 36918179)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTCATGTGAGGCCTACAGACTCAATGGAAAATAYTGGTCAGGCAACTA[C/A]ACCATAGACCCAGATCTGAGCGGACCACTGAAGCCTTTYACCGTCTACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/82eg8ksz