LOC559131

Ensembl ID:
ENSDARG00000074519
Human Orthologue:
AC114947.1
Human Description:
Serine/threonine-protein kinase NIM1 [Source:UniProtKB/Swiss-Prot;Acc:Q8IY84]
Mouse Orthologues:
E130304F04Rik, E130304F04Rik
Mouse Descriptions:
RIKEN cDNA E130304F04 gene Gene [Source:MGI Symbol;Acc:MGI:2442399]
RIKEN cDNA E130304F04 gene Gene [Source:MGI Symbol;Acc:MGI:2442399]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6190 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111841 Nonsense 337 445 5 5
Genomic Location:
Chromosome 11 (position 6257532)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGCAGCACACTGTCACAGCTGATGATCTGCTCCTGGATGCAGTGCATC[G/T]AATACCCCAAACCYTACCCCACATTCAGCGGGACACCCGGCTATCTGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2jz7j1ga