LOC100333959

Ensembl ID:
ENSDARG00000074512
Human Orthologue:
SAMHD1
Human Description:
SAM domain and HD domain 1 [Source:HGNC Symbol;Acc:15925]
Mouse Orthologue:
Samhd1
Mouse Description:
SAM domain and HD domain, 1 Gene [Source:MGI Symbol;Acc:MGI:1927468]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39727 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18448 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39727
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112794 Essential Splice Site 354 463 11 14
Genomic Location (Zv9):
Chromosome 1 (position 59294770)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57759738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAAAGTTTATCAGAGAAGTTCGTCTGACTGAGAAAAACATGTCAAAG[G/A]TTGGACAGAAACTGAAAAACATACATCATATAGTTTCATTAAACTTCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18448
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112794 Essential Splice Site 420 463 13 14
Genomic Location (Zv9):
Chromosome 1 (position 59296787)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57757745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACAGCAAGMGAAAACCCAATGAAGCTTCAACYATTMAGGATTATCAGG[T/G]AACATCGACACTTTTTAGCCGTTTTATATTACAGAAATGTATAYGTGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link