si:ch211-1n9.11

Ensembl ID:
ENSDARG00000074509
ZFIN ID:
ZDB-GENE-090312-188
Description:
Novel protein similar to vertebrate tachykinin receptor family [Source:UniProtKB/TrEMBL;Acc:B8A5E6]
Human Orthologue:
TACR2
Human Description:
tachykinin receptor 2 [Source:HGNC Symbol;Acc:11527]
Mouse Orthologue:
Tacr2
Mouse Description:
tachykinin receptor 2 Gene [Source:MGI Symbol;Acc:MGI:98477]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42186 Nonsense Mutation detected in F1 DNA During 2017
sa17156 Nonsense Available for shipment Available now
sa11002 Nonsense Available for shipment Available now
sa22285 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42186
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110745 Nonsense 41 376 1 5
ENSDART00000142129 Nonsense 17 329 1 5

The following transcripts of ENSDARG00000074509 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23105402)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22834740
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCTGTTCGAGCAGCCGGACTGGCAGGTGGCATTATGGGCGATTGCATA[T/A]ACTTTGATCGTAATTATTTCCTTCATTGGCAATGTCACAGTTATTTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17156
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110745 Nonsense 104 376 1 5
ENSDART00000142129 Nonsense 80 329 1 5
ENSDART00000110745 Nonsense 104 376 1 5
ENSDART00000142129 Nonsense 80 329 1 5

The following transcripts of ENSDARG00000074509 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23105590)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22834928
KASP Assay ID:
2260-6349.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACMGTTTTTAATTTCGTTTATGCTTTGCACAATGACTGGTATTTTGGTT[T/A]AGGATATTGTAAATTTCAAAACTTCTTCCCAATAACAGCAATGTTCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11002
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110745 Nonsense 104 376 1 5
ENSDART00000142129 Nonsense 80 329 1 5
ENSDART00000110745 Nonsense 104 376 1 5
ENSDART00000142129 Nonsense 80 329 1 5

The following transcripts of ENSDARG00000074509 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23105590)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22834928
KASP Assay ID:
2260-6349.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACMGTTTTTAATTTCGTTTATGCTTTGCACAATGACTGGTATTTTGGTT[T/A]AGGATATTGTAAATTTCAAAACTTCTTCCCAATAACAGCAATGTTCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22285
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110745 Essential Splice Site 197 376 2 5
ENSDART00000142129 Essential Splice Site 173 329 2 5

The following transcripts of ENSDARG00000074509 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23106998)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22836336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGTATGGTGGAATGGCCTGACGATTATGGAGGGAAACATCAGCTCTC[G/A]TAAGAAATGACTTTGCATGTTGTGGTGGGATTTGTGCTCTGAAAAGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link