LOC100334034

Ensembl ID:
ENSDARG00000074508
Human Orthologue:
HAP1
Human Description:
huntingtin-associated protein 1 [Source:HGNC Symbol;Acc:4812]
Mouse Orthologue:
Hap1
Mouse Description:
huntingtin-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1261831]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35041 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38828 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112328 Essential Splice Site 144 634 4 16
ENSDART00000112328 Essential Splice Site 144 634 4 16
Genomic Location (Zv9):
Chromosome 11 (position 11738112)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11633115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACTTTTATGCCAGCACTGAAGATATAGAGCACGCCACAGAAACACTG[T/A]AAGTCTAACACACAGACACACACACCTATGTGTCTATGTGATCGACAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112328 Essential Splice Site 144 634 4 16
ENSDART00000112328 Essential Splice Site 144 634 4 16
Genomic Location (Zv9):
Chromosome 11 (position 11738112)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11633115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACTTTTATGCCAGCACTGAAGATATAGAGCACGCCACAGAAACACTG[T/A]AAGTCTAACACACAGACACACACACCTATGTGTCTATGTGATCGACAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link