LOC795408

Ensembl ID:
ENSDARG00000074506
Human Orthologue:
KIAA0195
Human Description:
KIAA0195 [Source:HGNC Symbol;Acc:28983]
Mouse Orthologue:
2310067B10Rik
Mouse Description:
RIKEN cDNA 2310067B10 gene Gene [Source:MGI Symbol;Acc:MGI:1919197]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35340 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14844 Nonsense Mutation detected in F1 DNA During 2016
sa35339 Nonsense Mutation detected in F1 DNA During 2016
sa42072 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111259 Essential Splice Site 92 1346 3 30
Genomic Location:
Chromosome 12 (position 35140572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTGGTGGTGGGGCTGTTGTCTTGTCACGGCAGCCAGCCGGAGGGCAG[G/A]TGGGCGGAGCTTAATGCAAAACACTTTTAATTTTTCATTTTTAAAATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111259 Nonsense 120 1346 4 30
Genomic Location:
Chromosome 12 (position 35140395)
KASP Assay ID:
1641-0507.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCTCCTGCTGCTGCTCAACCTCTTCCTCATCGGACGGCAGCAGAGGT[T/A]ACGAATAAGTGAGATGGTGCGGCGGCTCAAGTCCATCATCTCACAACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35339
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111259 Nonsense 176 1346 5 30
Genomic Location:
Chromosome 12 (position 35137773)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTCCCACCTCCCCTTCGTGGTCGCTGCATTGGACGTTCAGGGATGAA[C/T]AGCTGGTCAATCTACCTGTCAGCCTCCTGGTGGAAGGTGATGTCATCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111259 Nonsense 842 1346 17 30
Genomic Location:
Chromosome 12 (position 35121293)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTACGGCTCATCGAGAACCTGGTGGGAGCCTGCATACGCTTTGTGTA[C/A]TTCTCAATGGAAGACGAACTGCGCAGCAAAGTATGACATTGATAGGAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link