LOC795408

Ensembl ID:
ENSDARG00000074506
Human Orthologue:
KIAA0195
Human Description:
KIAA0195 [Source:HGNC Symbol;Acc:28983]
Mouse Orthologue:
2310067B10Rik
Mouse Description:
RIKEN cDNA 2310067B10 gene Gene [Source:MGI Symbol;Acc:MGI:1919197]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14844 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111259 Nonsense 120 1346 4 30
Genomic Location:
Chromosome 12 (position 35140395)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCTCCTGCTGCTGCTCAACCTCTTCCTCATCGGACGGCAGCAGAGGT[T/A]ACGAATAAGTGAGATGGTGCGGCGGCTCAAGTCCATCATCTCACAACTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yv4c1hx6