CHD9

Ensembl ID:
ENSDARG00000074498
Description:
chromodomain helicase DNA binding protein 9 [Source:HGNC Symbol;Acc:25701]
Human Orthologue:
CHD9
Human Description:
chromodomain helicase DNA binding protein 9 [Source:HGNC Symbol;Acc:25701]
Mouse Orthologue:
Chd9
Mouse Description:
chromodomain helicase DNA binding protein 9 Gene [Source:MGI Symbol;Acc:MGI:1924001]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11275 Nonsense Available for shipment Available now
sa5766 Essential Splice Site Mutation detected in F1 DNA Unknown
sa21008 Nonsense Mutation detected in F1 DNA During 2014
sa15134 Essential Splice Site Available for shipment Available now
sa5431 Nonsense Mutation detected in F1 DNA During 2014
sa21009 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11275
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027807 Nonsense 583 2948 2 38
Genomic Location:
Chromosome 7 (position 37884813)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGCAGATGGAGTCGCCCCTTTCGGATGATAAACAACAGAAGGCCAAT[C/T]GAATCATCTCTGAGGCCATCGCCAAAGCACGAGAGAGGGGAGARAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5766
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027807 Essential Splice Site 1497 2948 19 38
Genomic Location:
Chromosome 7 (position 37925178)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTGGGCCAAGAAAGCTGAAATTGAYATGGATACAGTCAATGGCAGAG[T/A]AAGTTATATGCAAANCAAAAAAGGAGGAGAAAAGCCCACATCCTTGTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027807 Nonsense 1632 2948 22 38
Genomic Location:
Chromosome 7 (position 37927935)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAATTTGTAAGAGTCATTAAGAGCTTTTTAACTGTGATGCAGGCTTGT[C/A]GACTCCAGTACCCCGAGGCAGAAAAGGAAAGAAGATGAAGACTCAGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15134
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027807 Essential Splice Site 1806 2948 26 38
Genomic Location:
Chromosome 7 (position 37934333)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGACCCTGAGTATAAGYCTGCTCCTGCTTTGATGAAGGATGATATGGAG[G/A]TAGGCAAGTGGAAGAAGGAGAACTGGACCTGATAACACATGAGGCCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027807 Nonsense 2431 2948 33 38
Genomic Location:
Chromosome 7 (position 37941623)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCCCTGAAGCGCCCCCTGGAGGGAGAAGAAGGACCTCTTGCCCAACAG[C/T]AGTACTTAGCCCGACTACAAGAGTTGCAGAATGCGTCTGATATCAGCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027807 Nonsense 2652 2948 37 38
Genomic Location:
Chromosome 7 (position 37943372)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATTTAAGCCGGTTCCTGCAAGAGAACCCAGAGTATGGGGTTCCACCC[G/T]AGTGGGCCGATGTTGTCAAACAGTCTGTGAGTAAAAATAAAGACGTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/scxwa37g