CHD9

Ensembl ID:
ENSDARG00000074498
Description:
chromodomain helicase DNA binding protein 9 [Source:HGNC Symbol;Acc:25701]
Human Orthologue:
CHD9
Human Description:
chromodomain helicase DNA binding protein 9 [Source:HGNC Symbol;Acc:25701]
Mouse Orthologue:
Chd9
Mouse Description:
chromodomain helicase DNA binding protein 9 Gene [Source:MGI Symbol;Acc:MGI:1924001]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40950 Nonsense Mutation detected in F1 DNA During 2016
sa11275 Nonsense Available for shipment Available now
sa40951 Nonsense Mutation detected in F1 DNA During 2016
sa38626 Nonsense Mutation detected in F1 DNA During 2016
sa21008 Nonsense Available for shipment Available now
sa15134 Essential Splice Site Available for shipment Available now
sa26993 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21009 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40950
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027807 Nonsense 469 2948 1 38
Genomic Location (Zv9):
Chromosome 7 (position 37827264)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 36228865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCAACATGATCAAAGACTTGATGACCTGGGTGAAGCTCCCGACCTTT[T/A]GGAGGATGAGCTGCTGCCCCAGCTGGAGGCACTAGATCAGGAAGAGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11275
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027807 Nonsense 583 2948 2 38
Genomic Location (Zv9):
Chromosome 7 (position 37884813)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 36286414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGCAGATGGAGTCGCCCCTTTCGGATGATAAACAACAGAAGGCCAAT[C/T]GAATCATCTCTGAGGCCATCGCCAAAGCACGAGAGAGGGGAGARAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40951
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027807 Nonsense 731 2948 4 38
Genomic Location (Zv9):
Chromosome 7 (position 37904851)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 36306452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTCATCGTCAAAGCCAAAAAGAGCAGCTCCAATAAAAAGCCTGCAGTG[C/T]AATTGTTTGTGGTGAGAACATACAATCTCAGCGCTCTCTCATAAGCATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027807 Nonsense 1336 2948 16 38
Genomic Location (Zv9):
Chromosome 7 (position 37922835)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 36324436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCACTGCGGCCGACACCTGTATCATCTTTGACTCTGACTGGAATCCA[C/T]AAAACGACCTGCAGGTACGCACACGTAAATATTTCTATTGGTGGTTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21008
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027807 Nonsense 1632 2948 22 38
Genomic Location (Zv9):
Chromosome 7 (position 37927935)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 36329536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAATTTGTAAGAGTCATTAAGAGCTTTTTAACTGTGATGCAGGCTTGT[C/A]GACTCCAGTACCCCGAGGCAGAAAAGGAAAGAAGATGAAGACTCAGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15134
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027807 Essential Splice Site 1806 2948 26 38
Genomic Location (Zv9):
Chromosome 7 (position 37934333)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 36335934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGACCCTGAGTATAAGYCTGCTCCTGCTTTGATGAAGGATGATATGGAG[G/A]TAGGCAAGTGGAAGAAGGAGAACTGGACCTGATAACACATGAGGCCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027807 Essential Splice Site 1974 2948 29 38
Genomic Location (Zv9):
Chromosome 7 (position 37937120)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 36338721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTATTGCCATGTGCAGAAGAGTCTGCCGCCTGCCTGCTATAGAGGGAG[G/A]TGAGCCAAACTCATCTATACACTCACACACTCAAAACAATTTTCCTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21009
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027807 Nonsense 2652 2948 37 38
Genomic Location (Zv9):
Chromosome 7 (position 37943372)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 36344973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATTTAAGCCGGTTCCTGCAAGAGAACCCAGAGTATGGGGTTCCACCC[G/T]AGTGGGCCGATGTTGTCAAACAGTCTGTGAGTAAAAATAAAGACGTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link