si:ch73-215d9.1

Ensembl ID:
ENSDARG00000074486
ZFIN ID:
ZDB-GENE-100922-40
Human Orthologue:
KIAA0319
Human Description:
KIAA0319 [Source:HGNC Symbol;Acc:21580]
Mouse Orthologue:
D130043K22Rik
Mouse Description:
RIKEN cDNA D130043K22 gene Gene [Source:MGI Symbol;Acc:MGI:3036268]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30691 Nonsense Mutation detected in F1 DNA During 2017
sa18427 Essential Splice Site Available for shipment Available now
sa14911 Nonsense Available for shipment Available now
sa16403 Nonsense Available for shipment Available now
sa42778 Nonsense Mutation detected in F1 DNA During 2017
sa31007 Nonsense Mutation detected in F1 DNA During 2017
sa42779 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113025 Nonsense 194 1061 1 25
ENSDART00000143692 Nonsense 7 773 1 18
Genomic Location (Zv9):
Chromosome 16 (position 38322369)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36954897
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCGGTAGAGCAAGAAGAGCAAACTGGGCTTTATGATTGGCCACCTGTT[C/T]AAAGAAAAGAGGAATTCAACCAATCAGAGACGGAGAGAGGCAGTAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18427
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113025 Essential Splice Site 306 1061 None 25
ENSDART00000143692 Essential Splice Site 123 773 None 18
Genomic Location (Zv9):
Chromosome 16 (position 38324926)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36957454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCCAGCCAACACTGAAGCTACACCGCAGATGACTTCAGAACAGCCAGG[T/G]ACTGTGCGCAATATTGGGGAAAGTTACTTTAAAAGCAAAAATGCTGTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14911
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113025 Nonsense 501 1061 13 25
ENSDART00000143692 Nonsense 278 773 7 18
Genomic Location (Zv9):
Chromosome 16 (position 38328749)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36961277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGAAAAAGGTGGACGGCCCGTTTTGGACACCTGAAGGTCCTGTTAAY[A/T]AAMCTGTACTGCAGCTGAAAAATCTTTTAYCTGGAGAATATACCTTCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16403
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113025 Nonsense 542 1061 14 25
ENSDART00000143692 Nonsense 319 773 8 18
Genomic Location (Zv9):
Chromosome 16 (position 38331072)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36963600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTGAGCGACTCCAGCACTGCCACCTTGAGGGTCAGCATCCCAAAAGAT[G/T]AGCCTCCTCTGGCCAGAGCGGGCACAGACCGGGTCATTACCCTGCCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42778
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113025 Nonsense 863 1061 20 25
ENSDART00000143692 Nonsense 639 773 14 18
ENSDART00000113025 Nonsense 863 1061 20 25
ENSDART00000143692 Nonsense 639 773 14 18
Genomic Location (Zv9):
Chromosome 16 (position 38339149)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36971677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAACAGAGAGACACAGTGATCAGACAGCTGGCCGCACTTCTGCATGTGT[T/A]GGACTCAGACATCGCACTAAAGGCTCTACATGGACAGTCTGACATCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31007
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113025 Nonsense 863 1061 20 25
ENSDART00000143692 Nonsense 639 773 14 18
ENSDART00000113025 Nonsense 863 1061 20 25
ENSDART00000143692 Nonsense 639 773 14 18
Genomic Location (Zv9):
Chromosome 16 (position 38339149)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36971677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAACAGAGAGACACAGTGATCAGACAGCTGGCCGCACTTCTGCATGTGT[T/A]GGACTCAGACATCGCACTAAAGGCTCTACATGGACAGTCTGACATCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42779
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113025 Nonsense 907 1061 21 25
ENSDART00000143692 Nonsense 683 773 15 18
Genomic Location (Zv9):
Chromosome 16 (position 38340089)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36972617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTTGATCCCTGGCCCTAAACTTGCCCGCCTGCTGAGAAACCAGCTGT[T/A]GAGAGAGAAAAGCGACTTCTTGCTCTTTAGGGTCTTAAGAGTGGACACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Radiation response: Radiation pharmacogenomics: a genome-wide association approach to identify radiation response biomarkers using human lymphoblastoid cell lines. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link