cnksr2

Ensembl ID:
ENSDARG00000074480
ZFIN ID:
ZDB-GENE-060228-5
Human Orthologue:
CNKSR2
Human Description:
connector enhancer of kinase suppressor of Ras 2 [Source:HGNC Symbol;Acc:19701]
Mouse Orthologue:
Cnksr2
Mouse Description:
connector enhancer of kinase suppressor of Ras 2 Gene [Source:MGI Symbol;Acc:MGI:2661175]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37902 Nonsense Mutation detected in F1 DNA During 2016
sa37903 Nonsense Mutation detected in F1 DNA During 2016
sa6772 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37902
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110241 Nonsense 442 1025 12 21
ENSDART00000142351 Nonsense 455 684 12 15
Genomic Location (Zv9):
Chromosome 24 (position 26094279)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25419515
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCTTTTAGGTCGTCTGAGGCCCATCTCAATGCCTGTGGAGTATAACT[G/A]GGTTCCTGACTATGAAGACCCAGCTAGAGTGAAGAGAGACGGTCGGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110241 Nonsense 694 1025 18 21
ENSDART00000142351   None 684 None 15
Genomic Location (Zv9):
Chromosome 24 (position 26126857)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25386937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGAGTGAAAGTGATCATGAAGACAATGAGACGCCCTCGACGCCCAAG[C/T]AAGACAGCCCACCACCCCCTTATGACACATACCCACGGCCACCCTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110241 Nonsense 933 1025 20 21
ENSDART00000142351 Nonsense 590 684 14 15
Genomic Location (Zv9):
Chromosome 24 (position 26144047)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25369747
KASP Assay ID:
554-5163.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACTCGTCTGGAGTACAAACWTCTTTTCATCCGGCGTTGCAACGATCCA[C/T]AGCTAAATGACAAACTGCATCACCTTCGCATCCTGCAGAGCAYGCTAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link