LOC100333151

Ensembl ID:
ENSDARG00000074474
Human Orthologue:
CPEB4
Human Description:
cytoplasmic polyadenylation element binding protein 4 [Source:HGNC Symbol;Acc:21747]
Mouse Orthologue:
Cpeb4
Mouse Description:
cytoplasmic polyadenylation element binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1914829]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24025 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115341 Essential Splice Site 553 602 8 9
Genomic Location:
Chromosome 21 (position 39720820)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGGATCTGTTGTGTTGAATTAGTATTTAGTTACTTGGCTTATTGTTAC[A/T]GGTCCAAATTCGCCCATGGAATCTTAACGATAGTGACTTTGTGATGGATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Waist-hip ratio: Meta-analysis identifies 13 new loci associated with waist-hip ratio and reveals sexual dimorphism in the genetic basis of fat distribution. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/da608ol6