gdpd3

Ensembl ID:
ENSDARG00000074466
ZFIN ID:
ZDB-GENE-040426-2279
Description:
glycerophosphodiester phosphodiesterase domain containing 1 like [Source:RefSeq peptide;Acc:NP_9983
Human Orthologue:
GDPD3
Human Description:
glycerophosphodiester phosphodiesterase domain containing 3 [Source:HGNC Symbol;Acc:28638]
Mouse Orthologue:
Gdpd3
Mouse Description:
glycerophosphodiester phosphodiesterase domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1915866]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16999 Nonsense Available for shipment Available now
sa20018 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10838 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16999
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103748 Nonsense 53 315 3 11
Genomic Location:
Chromosome 3 (position 26835146)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTTGTCTRACCTCCTGCTCTCTGTCCTCAGGTTCTGGTGAAAGGATC[G/T]AGAACACTATAGAGGCCTTCACACAGTRAGTGATCAGTTATACTGGGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103748 Essential Splice Site 191 315 7 11
ENSDART00000103748 Essential Splice Site 191 315 7 11
Genomic Location:
Chromosome 3 (position 26837816)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTGGGCCTCTGTTGACTCTACCATCATGGAAAACTGTCGCAAAATAG[T/A]GCGTGTGCACTTGTATCCCTCTCTGCAAGCTTTGTTTCAGTAATAAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10838
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103748 Essential Splice Site 191 315 7 11
ENSDART00000103748 Essential Splice Site 191 315 7 11
Genomic Location:
Chromosome 3 (position 26837816)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTGGGCCTCTGTTGACTCWASCATCATGGAAAACTGTCGCAAAATAG[T/C]GCGTGTGCACTTGTATCCCTCTCTGCAAGCTTTGTTTYAGTAATAAATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vui9phz8