A8WFV8_DANRE

Ensembl ID:
ENSDARG00000074465
Description:
LOC798746 protein [Source:UniProtKB/TrEMBL;Acc:A8WFV8]
Human Orthologue:
VPS13C
Human Description:
vacuolar protein sorting 13 homolog C (S. cerevisiae) [Source:HGNC Symbol;Acc:23594]
Mouse Orthologue:
Vps13c
Mouse Description:
vacuolar protein sorting 13C (yeast) Gene [Source:MGI Symbol;Acc:MGI:2444207]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6079 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10606 Nonsense Available for shipment Available now
sa20968 Essential Splice Site Available for shipment Available now
sa20967 Nonsense Mutation detected in F1 DNA During 2014
sa9371 Nonsense Mutation detected in F1 DNA During 2014
sa17562 Nonsense Available for shipment Available now
sa20966 Nonsense Mutation detected in F1 DNA During 2014
sa20965 Nonsense Mutation detected in F1 DNA During 2014
sa12529 Essential Splice Site Available for shipment Available now
sa20964 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333 Essential Splice Site 48 443 2 15
ENSDART00000112651 Essential Splice Site 48 3753 2 84
Genomic Location:
Chromosome 7 (position 31054865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGGAAATGTGGTGTTGGAAAATCTGAAGGTGAAAGAAAATGCWTTGG[T/G]AAGTATGTACTGGACATTAATCATATTTAAATGGAATAAGTTTAATTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333 None None 443 None 15
ENSDART00000112651 Nonsense 752 3753 23 84
Genomic Location:
Chromosome 7 (position 31024975)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTTTCTGCCAGTTTYTCATCTYTAGARGAAATCATGGACAGAGCGTAT[G/T]AAAGATATTCACTGGAGYTGCGCAGTGTCCAGATACTCTACAGCAGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20968
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333 None None 443 None 15
ENSDART00000112651 Essential Splice Site 885 3753 26 84
Genomic Location:
Chromosome 7 (position 31021546)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCCCACAGTTCTGTCCTATGCTGTTGAGTCAGGTCAGAGAGAAAGAG[T/A]AGAAAAATCTTACAATAATAACCACATACTATAAATTTGTTGTTGAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20967
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333 None None 443 None 15
ENSDART00000112651 Nonsense 1175 3753 34 84
Genomic Location:
Chromosome 7 (position 31017602)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGCTTTAAGATGACCCTATACCCTGGGGCCACTGAGGGGGATGGCTA[C/A]ACTGACACCTCCAAAGTGGATGGCAAAGTTATCATGAGACTTGGCTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333 None None 443 None 15
ENSDART00000112651 Nonsense 2139 3753 52 84
Genomic Location:
Chromosome 7 (position 30999508)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTGCGCTGGTCGCCTCGTTCCAGTGTGATTTCAGTCTGCTGTCAGAA[G/T]AAGCCGGTCAGACCATGAAAGCCAATGTCAGGAGCYTGAAAGTGCTYGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333 None None 443 None 15
ENSDART00000112651 Nonsense 2227 3753 54 84
Genomic Location:
Chromosome 7 (position 30997803)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACCATCACAGCAGCCATGGCACCCAAACCCAAAGAAGAGCTGTCACAG[C/T]AGAAGTCTGGTGACCAGAACAGCCTCTGGTCTTTRATGAGCGTCGCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333 None None 443 None 15
ENSDART00000112651 Nonsense 2941 3753 63 84
Genomic Location:
Chromosome 7 (position 30989961)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGAGCTCCAAATCATTCTTCTTTAACAAGCAGGACAGCGGGACTCTGT[T/A]GCGCATGGATCAGGTGATCATGCTTTGGCTGTGAATGTGATGCCTAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20965
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333 None None 443 None 15
ENSDART00000112651 Nonsense 3412 3753 75 84
Genomic Location:
Chromosome 7 (position 30981257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGAAATTCAGATTCTTTTCTCTCCTCATAGTTTCTGACACAGATGTA[T/A]GTGCTGGTTTTGGGTCTGGATGTTCTTGGAAATCCATTCGGGCTGATCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333 None None 443 None 15
ENSDART00000112651 Essential Splice Site 3444 3753 75 84
Genomic Location:
Chromosome 7 (position 30981159)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGGGCTTATCAGAAGGAGTGGAAGCTTTCTTCTATGAGCCCATTCAGG[T/G]CTGAAACGTTCRGTTCATTTATCTCTCCATTCAGRCCCCATCGTTTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20964
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333 None None 443 None 15
ENSDART00000112651 Nonsense 3670 3753 82 84
Genomic Location:
Chromosome 7 (position 30969160)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATGTGTGTGAAGGAGATCGATGTGATCGGACATTTCAATAAAGAATG[G/A]GAATGTCAGTTTGAGAGTTTCCAGAGACCTCCATGCACAGAAGGAGGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w769xlju