A8WFV8_DANRE

Ensembl ID:
ENSDARG00000074465
Description:
LOC798746 protein [Source:UniProtKB/TrEMBL;Acc:A8WFV8]
Human Orthologue:
VPS13C
Human Description:
vacuolar protein sorting 13 homolog C (S. cerevisiae) [Source:HGNC Symbol;Acc:23594]
Mouse Orthologue:
Vps13c
Mouse Description:
vacuolar protein sorting 13C (yeast) Gene [Source:MGI Symbol;Acc:MGI:2444207]

Alleles

There are 16 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40913 Nonsense Mutation detected in F1 DNA During 2016
sa6079 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34089 Nonsense Mutation detected in F1 DNA During 2016
sa10606 Nonsense Available for shipment Available now
sa20968 Essential Splice Site Available for shipment Available now
sa38617 Essential Splice Site Mutation detected in F1 DNA During 2016
sa26966 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20967 Nonsense Mutation detected in F1 DNA During 2016
sa40912 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9371 Nonsense Mutation detected in F1 DNA During 2016
sa17562 Nonsense Available for shipment Available now
sa20966 Nonsense Mutation detected in F1 DNA During 2016
sa40911 Nonsense Mutation detected in F1 DNA During 2016
sa20965 Nonsense Available for shipment Available now
sa12529 Essential Splice Site Available for shipment Available now
sa20964 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40913
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333 Nonsense 18 443 1 15
ENSDART00000112651 Nonsense 18 3753 1 84
Genomic Location (Zv9):
Chromosome 7 (position 31060170)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29452512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTCGAGTCTTTAGTCAGTGATCTTTTAAACAGGTTTATTGGAGATTA[T/A]GTGGAAAACCTGGACAAGTCGCAGCTCAAGATTGGCATATGGGGAGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333 Essential Splice Site 48 443 2 15
ENSDART00000112651 Essential Splice Site 48 3753 2 84
Genomic Location (Zv9):
Chromosome 7 (position 31054865)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29447207
KASP Assay ID:
554-3857.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGGAAATGTGGTGTTGGAAAATCTGAAGGTGAAAGAAAATGCWTTGG[T/G]AAGTATGTACTGGACATTAATCATATTTAAATGGAATAAGTTTAATTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333   None 443 None 15
ENSDART00000112651 Nonsense 529 3753 19 84
Genomic Location (Zv9):
Chromosome 7 (position 31027940)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29420282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGCCTGGACTGAACACTCAAATATATGAATGTACATTTATGTGCAGTA[T/A]GTAGCTGTGATTGTCAACTTTAAACTGCTGAGCACTTCGGTAACGTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333   None 443 None 15
ENSDART00000112651 Nonsense 752 3753 23 84
Genomic Location (Zv9):
Chromosome 7 (position 31024975)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29417317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTTTCTGCCAGTTTYTCATCTYTAGARGAAATCATGGACAGAGCGTAT[G/T]AAAGATATTCACTGGAGYTGCGCAGTGTCCAGATACTCTACAGCAGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20968
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333   None 443 None 15
ENSDART00000112651 Essential Splice Site 885 3753 26 84
Genomic Location (Zv9):
Chromosome 7 (position 31021546)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29413888
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCCCACAGTTCTGTCCTATGCTGTTGAGTCAGGTCAGAGAGAAAGAG[T/A]AGAAAAATCTTACAATAATAACCACATACTATAAATTTGTTGTTGAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333   None 443 None 15
ENSDART00000112651 Essential Splice Site 886 3753 27 84
Genomic Location (Zv9):
Chromosome 7 (position 31021470)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29413812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACTATAAATTTGTTGTTGAATTGACTTTATTCACCGGTAATGCATACA[G/A]TATTTGACTGTATTTATGCATTCAGAGTCTGATGAAGACACTAGTGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333   None 443 None 15
ENSDART00000112651 Essential Splice Site 1114 3753 32 84
Genomic Location (Zv9):
Chromosome 7 (position 31018936)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29411278
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGCTGTCTGTGATGACAGAAGCAACATCGCTGATATACGGGTCCAAG[G/T]TAAAAAAAAAATGTACTAGTGTTATTTTAGCATCAAATGGCATCATGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20967
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333   None 443 None 15
ENSDART00000112651 Nonsense 1175 3753 34 84
Genomic Location (Zv9):
Chromosome 7 (position 31017602)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29409944
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGCTTTAAGATGACCCTATACCCTGGGGCCACTGAGGGGGATGGCTA[C/A]ACTGACACCTCCAAAGTGGATGGCAAAGTTATCATGAGACTTGGCTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333   None 443 None 15
ENSDART00000112651 Essential Splice Site 1395 3753 38 84
Genomic Location (Zv9):
Chromosome 7 (position 31012369)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29404711
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGACTGATAAGTTTCTAGGGCTTAATTTGACCCTGTCGTCTTCTACA[G/T]ATGAAGCGGTTATAGATGAAGGACTGATGCAGACACTTCCAGTGGGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333   None 443 None 15
ENSDART00000112651 Nonsense 2139 3753 52 84
Genomic Location (Zv9):
Chromosome 7 (position 30999508)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29391850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTGCGCTGGTCGCCTCGTTCCAGTGTGATTTCAGTCTGCTGTCAGAA[G/T]AAGCCGGTCAGACCATGAAAGCCAATGTCAGGAGCYTGAAAGTGCTYGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333   None 443 None 15
ENSDART00000112651 Nonsense 2227 3753 54 84
Genomic Location (Zv9):
Chromosome 7 (position 30997803)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29390145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACCATCACAGCAGCCATGGCACCCAAACCCAAAGAAGAGCTGTCACAG[C/T]AGAAGTCTGGTGACCAGAACAGCCTCTGGTCTTTRATGAGCGTCGCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333   None 443 None 15
ENSDART00000112651 Nonsense 2941 3753 63 84
Genomic Location (Zv9):
Chromosome 7 (position 30989961)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29382303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGAGCTCCAAATCATTCTTCTTTAACAAGCAGGACAGCGGGACTCTGT[T/A]GCGCATGGATCAGGTGATCATGCTTTGGCTGTGAATGTGATGCCTAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333   None 443 None 15
ENSDART00000112651 Nonsense 3175 3753 68 84
Genomic Location (Zv9):
Chromosome 7 (position 30985877)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29378219
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTAAACTTTGGAAGAGTGCCCATGTTAATGAGACAGCCGTTTTCCTG[C/A]CAGATAAGGAGAAACTTCCTGCCTGGCATTCATGTTGAGCTGAAGCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20965
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333   None 443 None 15
ENSDART00000112651 Nonsense 3412 3753 75 84
Genomic Location (Zv9):
Chromosome 7 (position 30981257)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29373599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGAAATTCAGATTCTTTTCTCTCCTCATAGTTTCTGACACAGATGTA[T/A]GTGCTGGTTTTGGGTCTGGATGTTCTTGGAAATCCATTCGGGCTGATCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333   None 443 None 15
ENSDART00000112651 Essential Splice Site 3444 3753 75 84
Genomic Location (Zv9):
Chromosome 7 (position 30981159)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29373501
KASP Assay ID:
2259-8943.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGGGCTTATCAGAAGGAGTGGAAGCTTTCTTCTATGAGCCCATTCAGG[T/G]CTGAAACGTTCRGTTCATTTATCTCTCCATTCAGRCCCCATCGTTTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110333   None 443 None 15
ENSDART00000112651 Nonsense 3670 3753 82 84
Genomic Location (Zv9):
Chromosome 7 (position 30969160)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29361502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATGTGTGTGAAGGAGATCGATGTGATCGGACATTTCAATAAAGAATG[G/A]GAATGTCAGTTTGAGAGTTTCCAGAGACCTCCATGCACAGAAGGAGGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link