LOC793111

Ensembl ID:
ENSDARG00000074456
Human Orthologue:
C5orf35
Human Description:
chromosome 5 open reading frame 35 [Source:HGNC Symbol;Acc:28508]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4353 Nonsense F2 line generated During 2014
hu7858 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4353
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112019 Nonsense 13 285 1 6
ENSDART00000112019 Nonsense 13 285 1 6
Genomic Location:
Chromosome 10 (position 2711332)
KASP Assay ID:
554-2400.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAATGAACAATATGATTAAAGCTCTTTTTAAAGCCTTTGAGGTGAGGTG[G/A]AAGTCCTACAGACACAGATTTGTTCCCTGGATAGCGTTAAACCTGCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu7858
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112019 Nonsense 13 285 1 6
ENSDART00000112019 Nonsense 13 285 1 6
Genomic Location:
Chromosome 10 (position 2711332)
KASP Assay ID:
554-2400.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAATGAACAATATGATTAAAGCTCTTTTTAAAGCCTTTGAGGTGAGGTG[G/A]AAGTCCTACAGACACAGATTTGTTCCCTGGATAGCGTTAAACCTGCAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Triglycerides: Genetic variants influencing circulating lipid levels and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ixz3ou1c