dapk3

Ensembl ID:
ENSDARG00000074447
ZFIN ID:
ZDB-GENE-030131-3026
Human Orthologue:
DAPK3
Human Description:
death-associated protein kinase 3 [Source:HGNC Symbol;Acc:2676]
Mouse Orthologue:
Dapk3
Mouse Description:
death-associated protein kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1203520]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1728 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108859 Nonsense 281 451 8 8
ENSDART00000146103 Nonsense 281 453 9 9
Genomic Location (Zv9):
Chromosome 2 (position 37190968)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37487678
KASP Assay ID:
554-1673.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTGTTCAGTGTTTAACACAGTTCTTGTCCCATCAGGTCATTAAGAGA[C/T]GAAATGTTCGACCCGAAGAGAGCGAGCGCAAGCCTGAACGCAGGCGTCTR
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link