LOC793701

Ensembl ID:
ENSDARG00000074443
Human Orthologue:
GAS7
Human Description:
growth arrest-specific 7 [Source:HGNC Symbol;Acc:4169]
Mouse Orthologue:
Gas7
Mouse Description:
growth arrest specific 7 Gene [Source:MGI Symbol;Acc:MGI:1202388]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3457 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112152 Essential Splice Site 190 327 8 11
Genomic Location:
Chromosome 3 (position 47384796)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAYAAGCTGAAAGTCTTTACAGTAAATGACTTGTTTGTGTTGTGTTTTAC[A/T]GGCACGGAAGGCTTTAGCAGACCGACAGAAGGATCTTGAGGTGAAAACCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2ahffhmu