gp1bb

Ensembl ID:
ENSDARG00000074441
ZFIN ID:
ZDB-GENE-081104-406
Description:
platelet glycoprotein Ib beta chain [Source:RefSeq peptide;Acc:NP_001138284]
Human Orthologue:
GP1BB
Human Description:
glycoprotein Ib (platelet), beta polypeptide [Source:HGNC Symbol;Acc:4440]
Mouse Orthologue:
Gp1bb
Mouse Description:
glycoprotein Ib, beta polypeptide Gene [Source:MGI Symbol;Acc:MGI:107852]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21184 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21184
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112056 None None 207 None 2
ENSDART00000134324 None None 207 2 3
ENSDART00000143511 Essential Splice Site None 207 2 3
Genomic Location:
Chromosome 8 (position 4781547)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTTATATTACTGATGTATAGTGACCGGTGTTGTGTGTTTCTTCA[G/A]TGTGTGTGTGTGTGTGTGCTGGTATGAGGAGTGTTGTGCTGGTGTTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4x76kbn2