LOC571737

Ensembl ID:
ENSDARG00000074439
Human Orthologue:
PDE9A
Human Description:
phosphodiesterase 9A [Source:HGNC Symbol;Acc:8795]
Mouse Orthologue:
Pde9a
Mouse Description:
phosphodiesterase 9A Gene [Source:MGI Symbol;Acc:MGI:1277179]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30867 Essential Splice Site Mutation detected in F1 DNA During 2015
sa7009 Essential Splice Site Mutation detected in F1 DNA During 2015
sa18434 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30867
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111973 Essential Splice Site 239 518 10 18
Genomic Location:
Chromosome 5 (position 59965378)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGTGAAGGAGTTTAACATGAACCCAATAACTCTCAAAAGATGGCTGG[T/G]AGGGCAAACTTTATTTTCTCACCTGCATTTTAGACTTTTTGAATCAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111973 Essential Splice Site 392 518 14 18
Genomic Location:
Chromosome 5 (position 59969789)
KASP Assay ID:
554-5322.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAAAGTGGACAACTTTGACTGTACTAATGAGGAGCATGTTAAATCTG[T/A]ATGTGTTTCCCRCTATTATGACTCACATTGTTTGCAAATGCTTGTTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111973 Nonsense 504 518 18 18
Genomic Location:
Chromosome 5 (position 59971877)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCAKAYAAGCTATTATTTAGACTTATGGTTTGTCTTCTCTTTAGGCA[C/T]AKAAGAAGAAAACAGAGAGCATGTATTTGGGTGGNNNGAAGAAATAAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/583kp1gy