LOC571737

Ensembl ID:
ENSDARG00000074439
Human Orthologue:
PDE9A
Human Description:
phosphodiesterase 9A [Source:HGNC Symbol;Acc:8795]
Mouse Orthologue:
Pde9a
Mouse Description:
phosphodiesterase 9A Gene [Source:MGI Symbol;Acc:MGI:1277179]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7009 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18434 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111973 Essential Splice Site 392 518 14 18
Genomic Location:
Chromosome 5 (position 59969789)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAAAGTGGACAACTTTGACTGTACTAATGAGGAGCATGTTAAATCTG[T/A]ATGTGTTTCCCRCTATTATGACTCACATTGTTTGCAAATGCTTGTTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111973 Nonsense 504 518 18 18
Genomic Location:
Chromosome 5 (position 59971877)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCAKAYAAGCTATTATTTAGACTTATGGTTTGTCTTCTCTTTAGGCA[C/T]AKAAGAAGAAAACAGAGAGCATGTATTTGGGTGGNNNGAAGAAATAAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/583kp1gy