hhat

Ensembl ID:
ENSDARG00000074428
ZFIN ID:
ZDB-GENE-051118-1
Description:
protein-cysteine N-palmitoyltransferase HHAT [Source:RefSeq peptide;Acc:NP_001108362]
Human Orthologue:
HHAT
Human Description:
hedgehog acyltransferase [Source:HGNC Symbol;Acc:18270]
Mouse Orthologue:
Hhat
Mouse Description:
hedgehog acyltransferase Gene [Source:MGI Symbol;Acc:MGI:2444681]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9470 Essential Splice Site Available for shipment Available now
sa19176 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36421 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113846 Essential Splice Site 150 494 5 12
ENSDART00000113846 Essential Splice Site 150 494 5 12
Genomic Location (Zv9):
Chromosome 17 (position 25667328)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25807247
KASP Assay ID:
2261-1110.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTTGCTSCTCTCCACWCTTAATGTCAGTGCCCTTCAAGATTTACAGG[T/A]GTGTGTATGGGTTTGTCTGTCTRTCTGTAAYTKCATGTWTGTGAGACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113846 Essential Splice Site 150 494 5 12
ENSDART00000113846 Essential Splice Site 150 494 5 12
Genomic Location (Zv9):
Chromosome 17 (position 25667328)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25807247
KASP Assay ID:
2261-1110.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTTGCTGCTCTCCACTCTTAATGTCAGTGCCCTTCAAGATTTACAGG[T/A]GTGTGTATGGGTTTGTCTGTCTGTCTGTAACTGCATGTATGTGAGACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113846 Nonsense 356 494 10 12
Genomic Location (Zv9):
Chromosome 17 (position 25630243)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25770162
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATATGTGTGCGTTCTCAAAGCATGTGTTTATTCATTTCAGGTACATATA[T/A]GTGCCTCTGGGTGGTTCACGTCATGGTGCTTTCCGGAAGCTTCTCTCCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Whole-genome-wide association study in the Bulgarian population reveals HHAT as schizophrenia susceptibility gene. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link