IBTK

Ensembl ID:
ENSDARG00000074424
Description:
inhibitor of Bruton agammaglobulinemia tyrosine kinase [Source:HGNC Symbol;Acc:17853]
Human Orthologue:
IBTK
Human Description:
inhibitor of Bruton agammaglobulinemia tyrosine kinase [Source:HGNC Symbol;Acc:17853]
Mouse Orthologue:
Ibtk
Mouse Description:
inhibitor of Bruton agammaglobulinemia tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:1918677]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7239 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15648 Essential Splice Site Available for shipment Available now
sa15518 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114642 Essential Splice Site 1251 1349 30 33
Genomic Location:
Chromosome 16 (position 5837254)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAATKATCTTACTGATCATGCTACCCACTGTGCCACCGTGACACCTA[T/A]CCAAGGCTCAAAAANNNNNNNNNNNNNNNNNNNNACCTCATTCTTCAGTGCTGAAGTGCGCTCGCTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15648
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114642 Essential Splice Site 1266 1349 31 33
Genomic Location:
Chromosome 16 (position 5837583)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTARTTCTGCCAGTATWAACCCCACTAGCGCTACTAAATCAGCATCYG[T/A]AGGTCATTCATGACAGCWGTGCTCRTGTTGTCYTAACTTGCTTGAGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15518
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114642 Nonsense 1336 1349 33 33
Genomic Location:
Chromosome 16 (position 5840396)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTACAACGCATTTAACAAYCCAGATGAGCTGATACTRGTGGAGAGGK[C/A]AGATCAAGGCCCAGTSGCCACCCCRACCTGGAACAAACACTGAACCCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Corneal structure: Genome-wide association analyses identify multiple loci associated with central corneal thickness and keratoconus. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u8usyvor