ENSDARG00000074416

Ensembl ID:
ENSDARG00000074416

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38192 Nonsense Mutation detected in F1 DNA During 2017
sa30753 Nonsense Mutation detected in F1 DNA During 2017
sa30497 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112094 Nonsense 65 429 2 9
Genomic Location (Zv9):
Chromosome Zv9_NA461 (position 25831)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150204.1 25831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGAACATGGATTTTCCTTTTTTTTTTTGGCAGGAGGAGCGATCAGAG[C/T]GAGAGAAGACAGAGAGAAAGGTGTGGGCGAGGAAACAGAGAGTAATGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30753
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112094 Nonsense 276 429 6 9
Genomic Location (Zv9):
Chromosome Zv9_NA461 (position 46604)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150204.1 46604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTTGTGTGGTGGGCTGGGGTGCATTTCCCATATGCGACTGCTCTCTT[C/T]AACTCCTCAAGGGCAAGTTCAAGACCCCTCTTTTGCGTGGCGGGCCGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112094 Nonsense 375 429 8 9
Genomic Location (Zv9):
Chromosome Zv9_NA461 (position 63540)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150204.1 63540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGTCATTTTTTTTTATTTTTCAGAAAAAAGCCCCATTGGAGCTGTGT[C/A]GGCCTCAGAGCCCATGGACCAGACAAATCTCACCATCACCGAGAAAACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link