si:ch211-138h3.1

Ensembl ID:
ENSDARG00000074414
ZFIN ID:
ZDB-GENE-070705-31
Description:
semaphorin 4B [Source:RefSeq peptide;Acc:NP_001121824]
Human Orthologue:
SEMA4B
Human Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Mouse Orthologue:
Sema4b
Mouse Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32209 Nonsense Available for shipment Available now
sa11928 Essential Splice Site Available for shipment Available now
sa36655 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11879 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32209
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042074 Nonsense 2 827 1 14
ENSDART00000143899 Nonsense 2 830 2 15

The following transcripts of ENSDARG00000074414 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 25638953)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 25868726
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAAAAAAGATCTTCATGAGAGCCCGAAAATCTAGAGTCACAAAATGTG[G/A]ACACTAAACATGACACGTGTCTTTTTCCTGTTCCTCCTCAACGTCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11928
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042074 Essential Splice Site 113 827 3 14
ENSDART00000143899 Essential Splice Site 113 830 4 15

The following transcripts of ENSDARG00000074414 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 25603995)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 25833768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGCAGAGAAAAAGAGATGAATGCAGTTTCAAAGGGAAGGACTTAAAGG[T/A]GAGTCAATAAGATATTCATCAAAACGAGTKGAGAGATGTCTGTATACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042074 Essential Splice Site 183 827 5 14
ENSDART00000143899 Essential Splice Site 186 830 6 15

The following transcripts of ENSDARG00000074414 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 25596034)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 25825807
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCGATGCCCCTATAACCCTGAATACAAGTCCACGGCCATCATGGCTG[G/A]TATGTGCTAGAAAAACATTGGTGTTTACAACGGATGCATGCATGAATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042074 Nonsense 449 827 10 14
ENSDART00000143899 Nonsense 452 830 11 15

The following transcripts of ENSDARG00000074414 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 25575727)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 25805500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTACACRCAGCTCGCTGTGCAMAGAGTACAGGCTCTCCACAAGACCTA[T/A]KATGTGCTTTTCATTGGCACAGGTGAGCTCTTACACCACCACACATGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link