LOC100332329

Ensembl ID:
ENSDARG00000074413
Human Orthologue:
MYO9B
Human Description:
myosin IXB [Source:HGNC Symbol;Acc:7609]
Mouse Orthologue:
Myo9b
Mouse Description:
myosin IXb Gene [Source:MGI Symbol;Acc:MGI:106624]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30432 Nonsense Mutation detected in F1 DNA During 2017
sa30430 Nonsense Mutation detected in F1 DNA During 2017
sa30429 Nonsense Mutation detected in F1 DNA During 2017
sa30428 Nonsense Mutation detected in F1 DNA During 2017
sa30754 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112478 Nonsense 392 1825 11 44
Genomic Location (Zv9):
Chromosome Zv9_NA735 (position 155958)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5010844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATGCGGCCGGATATCGTGGCTCTCTTGCGGAGCAGTGACCGGTTTTA[T/A]GTCCGCCAGCTGATCGGGATGGACCCGGTGGCCATGTTTCGATGGGGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30430
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112478 Nonsense 856 1825 22 44
Genomic Location (Zv9):
Chromosome Zv9_NA735 (position 146330)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5020129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCAAACTTCCACCATCGAGAAGTCTGGAGAAACGGGAGCTTAGGAGA[C/T]AACGTGGCCTAGAGCATAACCAGAGAGAAAGTGAACGAGCAGCTTCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112478 Nonsense 1374 1825 36 44
Genomic Location (Zv9):
Chromosome Zv9_NA735 (position 132058)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5034401
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATTAAAGATATACTGTTGTTTGTGTGCTGTGGATCTAGTGTGAAGAT[G/T]AGCCTGGATCCAATCACTTTGGTGTACGCGTCGGCAACCTGGTCAACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30428
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112478 Nonsense 1483 1825 38 44
Genomic Location (Zv9):
Chromosome Zv9_NA735 (position 129433)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5037026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTTGTTAGAACTTCTGTTGTCTTTCTGCCGCAGAACTACCTGAGAAG[C/T]AAGAGCAATTGCAAGCGATTTACAGAGTTTTGGAGCAGCTGCCGACGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112478 Essential Splice Site 1615 1825 42 44
Genomic Location (Zv9):
Chromosome Zv9_NA735 (position 124005)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5042454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTCAGTTTTGTTACCTTGAGTTAAAGTTGGTATTTGTTTGGACTCTA[G/A]ATTCGGGAAAAGCCATCTTCTGACCTTTGTGTTGTACCTGAGAACGAGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link