brip1

Ensembl ID:
ENSDARG00000074410
ZFIN ID:
ZDB-GENE-081107-11
Description:
BRCA1 interacting protein C-terminal helicase 1 [Source:RefSeq peptide;Acc:NP_001103766]
Human Orthologue:
BRIP1
Human Description:
BRCA1 interacting protein C-terminal helicase 1 [Source:HGNC Symbol;Acc:20473]
Mouse Orthologue:
Brip1
Mouse Description:
BRCA1 interacting protein C-terminal helicase 1 Gene [Source:MGI Symbol;Acc:MGI:2442836]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17274 Essential Splice Site Available for shipment Available now
sa22659 Nonsense Mutation detected in F1 DNA During 2014
sa6381 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17274
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109262 Essential Splice Site 178 1216 5 20
ENSDART00000112643 Essential Splice Site 178 1216 4 19
Genomic Location:
Chromosome 15 (position 26863360)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTAAGAATGACAGGAAGCGTATTCGTACACCAGGCACAGAGCAGAAGG[T/C]ACAGCAAYAAATATCTTCTATTTCTGYGACATTATTGGCTTGTTGAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109262 Nonsense 419 1216 9 20
ENSDART00000112643 Nonsense 419 1216 8 19
Genomic Location:
Chromosome 15 (position 26843341)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTTCCTCTGCCAGATGGAAATCAATTTGAAGGAGCAGATTGTGGTGT[T/A]GGACGAAGCTCATAACATCGAGGACTGTGCCCGTGAGAGTGCTAGTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109262 Nonsense 707 1216 14 20
ENSDART00000112643 Nonsense 707 1216 13 19
Genomic Location:
Chromosome 15 (position 26837578)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACATTTCAGCATGCAGAGACATTTGCTTTYCAGGATGAAGTAGGAGCCT[T/A]GCTGTTGAAAGTGTGCCATACAGTGAGTCGAGGGGTYCTRTGCTTCCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2hprtzk6